Description :
From Genome Similarity Track
Location :
scaffold_63:77138- 79653
Transcript NameFunction/comments
g2513.t1hypothetical protein

Sequence
2515 bases(100 bases per row)
CAATCGGAGCAGAGTCCGGGGTAGAAGAATGAAGCGCGCCGAGGATACTGACAGCTCCAACGAGTTTATCGTGATGGCAGATCCTCCTTCATCTACATTC
AATTTGCTTGTCAACTGGCCACTCAGTTGCGATGACGATACATCCAGTCTTGACGATTGTGATGCAGAAGGTCGAAGCAACGGCGGAAAGATGTCGTCTC
TAGAGATGAATGAAAACGACGAGTTATCGGATGAGATCGACGTTCGTGATTCCATACGTTCCAACAGCGCTCCAGGAACGGGTCCAAACAAGTGGGTCAG
AAACTCCTACAAAAAATAGCGACATCAGAACAACTTAAAACCATCAAACCGCGACAGTCCATCTTTTACGTACCCTGGAATCAGCAATTCTGTCTCGGAT
GACCACTTCTTGCAAGGAAAAGTCGCATCGAAACTTGTCCTGACTGCTCTCCAACAGATTATCCTTCAAATTCAGCGCCACATTTGCCTCCAACGCAACT
AACGCTAATTCGCCAATCACACAACAAGGAATTTCATGTGGAAAACTCCCTCGTCGCCCCATAAAATGCTGGGGATAAGATCGCCCCTGGGCTGCAGACG
ACGCTCCACCGCTGCTTTCACGTGAAGATATTTCGTCAGGGATATCAATGACACTTTTCATCCACGTTTCGAATTGATGCGGCGCCTCGGAGTAGGAGAT
AAGAGCAATTTTGAATTCCTCGAGGAGAAAATGAACTGACAGCTGCCCCCACTTCGCAGCGTCAACATGTGAAGCAGCCAACGTTGGCTCCAAATCACCA
CCCTTCCCACCTTCTTCTTTTTGGATACCAGGTATACTCTCAGAGTCTGCTACCACCGACACACCCTCATAACTTTCAATCTGGTGAAGAATTCCTTGAG
CAGTATCGAGTATTGGGATAATTGCTTCGTAGAGTACTTCCAGTGCCAGGCAGACGTTTGTTTCGCTGATATTGATGCAAACAGGGTAAATTTCCACATC
CAATGCAATTTCTGACGAGACGTTTCGACTGGTGCCATCGCTGAAATCCTTGTTCATTGCCTCGACAGGAATACTGCATCGCACCTGTAAACCTGAACGA
TCGAGAATTGCAGTTTGATCCGCAAGGGAAGTCATCTGCAACCCTTCAACGGTCACAGTGGTTTGGTATGGCGCACACTTAGGTGCATCCTGTAAAGCCT
CCGACTCATCTCGCCGCAGCGAGATGGATATCGTTCCGAAGTCAATCACAAGACCTCGGTATGGTTGTGATTGCAGGGACACTCGTATGTCCTTCAACGG
CGTTGACGGAAGAACAATACACGGATGAAAGAGCTTCACATCCAGGTTGAAATTGTCGAGTATACGCGAGAGGAACAAAGCTATGTCGTCTCCTTTAACA
GCAGCAGCAACACCGTCGTTTTCATTTTCGAATGTGCCACCATCTTCAAGACTTCCATGTGAAGAAGAAGGGGGGCTTGACGCTTCGAATTTGAATTGTC
GCGCACTCCTGTTTGATGTATCGACTGCATCAAAAAATGGAGTCGAGCTTTCTGGTGGACGGTCAGATACCGGAGAGAGTCTTGCTAGTTGAAACTCGGA
ACCGAGAGACTCGGCACGTTTACGATCACGCTCCATGGCGCCGTTGCTCATATCGTTAGTGGCACGGTTGGATAAAAAGTGAGTTCGAAGCGGTCCGTCG
ATAACAAAGTTCGCTAGGCTTTCCACAAACTCGGGCTGCGCCAACAGACGAACAGGCTGCACTGACAAGCTAAGGCTTGATTTCTGGTTTTGCACCTCTG
GTTGCTTTTCACCTTCCGCAATGGCTATCGAATTCGGTTTTACATCTGTCGAGATCAAGCATTCCACGCACAAAATGTGCTTCGTTTCATCGGTTGCGAA
TGCAGCTGACGAGTCCAATCCAAATATCTCAATGTAATCTGAAGCTGACGCTTCTAAACCTTGCACAGCAGCACCGCTGATTCCAAGTCCGTCCTCTTGG
CGTTTCTTTGAGGATAGATCAAAAATCTTCACATCGCCCACCAAGCCGGACACATTGATTTGGTCTGTTGTGCCTGCACCAACCTGCACTTGCGAATCAA
GAATCGCCATGGATGCAACAGACTCACCACGATCAGAGAAACAGACCGAGACAGAATGGAGCCGGATATCCAGTTTCAAAGCGACGGCAGTGGAGTCATT
TCCGCCGTCTTGAGCGGAATTCTTCGAAGCATCAGGCGCTTGCTCGAATAAATGCTTCCTTGCTCTTTCTAAGTCGGCACGAACAGAATCAGTAAGGTTT
ACTGGCATCGAATATTCTTGGTTGATGGTAGGTGTGAGCTCGAACGGAGGAGGGAGGTCATCATTTGTGTCAGCCAGTGCAATGTCACCACCACCCATAG
CACCCCGTGAAGAAGTAGGAACCAAAGCAGTCTGAGACGATGATTCTTCAAAAAGCTCCAACAAAGAGCTCACATATGACTGATCGAAGATGAACTGCAC
CGAGCCGACTTGAAG