Description :
From Genome Similarity Track
Location :
Scaffold_5:771110- 780892
Transcript NameFunction/comments
Phypa_INRA-310PPTG_04583sorbitol dehydrogenase

Sequence
9782 bases(100 bases per row)
GGATTCCTCATTTTGGAAGCTCATACAATAATTTTTAGTCAGTACCTAGATGATCCCAATGCAAAGCACGTTGAAGCTCAGTAACAGCGCATTAGCAACT
CGAACTGGCCTTCCGAGTCAGTACATGGAAGTGATCCAATGCGAGTGTACCATTCGAGTCAGCATCCAGCAAGTTTTCATCGGATTTTTCCCTGCTATTT
TAGGACACTATTTTATGCCAAAGTCACGCAAGAGAACCGGATTTTTGCCAGTTGCACTTTTCTATAAAAATCACATCCAAGTCGTCGGCGTTACAGGCAA
TAACGTCATTCTGATTGCAGTTGAAGCTGAAAACTGTCGCTCGTGACGCGATCACCATTCGATCAACTGTTTCGATGGCTCCCAGTTGGCACCAACCGAT
CCGATAGCTCACAATGATCAGCTCACTTGCCAATTCCTCGTCCAGCACGCAAGACTTCAAACACCTCGACTACAATGGCCCCGACTCCATACAGCATTTC
AGCCGAACCTGTCCTGACGTGTGAACCTGTGCTGGCGTGTGAACCCGTGCTGGCGAGCGACTCAGTGCTGGTGAGCGACCCTGTGTTGGAATGTGACCCT
GTTCCGCCACAGAACCTTTCGCTCGTGCTCGAAAAGGGAGGCGCAGTCAAGTTCGAAGATCGTCCCGTGCCTGAGATCGAGGACCCACACGACGTGATCG
TGAACGTCCGCTACACGGGAATCTGTGGCAGTGACGTGCACTACTGCACACACGGCTGTATCGGCAAGTATGTGGTGGACAAGCCCATGGTTCTAGGCCA
CGAGTCAGCTGGTGTCGTGCACGCCGTGGGATCCGCCGTCAAGTCTCTCAAGGTGGGCGACCAAGTGGCCATGGAACCGGGAGTGCCATGCCGCCGGTGC
CGCCGCTGCCTCGAGGGGAACTACAACTTGTGTCCGGACATGGCGTTCGCGGCCACGCCCCCGTACGACGGCACGCTGGCCAAGTTCTACCGTATGCCCG
AAGATTTCTGCTACAAACTGCCGTCCAATGTCAGTATGCAAGAAGGAGCGATGCTCGAACCCACGGCTGTGGCCGTACACTTCTGCCGTCTGGCCAAGGT
GTCACCGGGCCATAAAGTCGTGGTGTTTGGTGTCGGCCCCGTGGGTCTGTTGACCTGCAAAGTGGCTCGGTACGTGTTCGGAGCCACGACAGTCGTCGGC
GTGGACGTCAATGAGAAACGTCTCGCGGTGGCCAAGGAGCACGGCGCGACGCACGTGTATCTTGGAAAGTCGGGTGTGACGCCTCAAGAATCGGCCGAGC
AGATCATTGCCGAGTGCGGACTGGGCGACGGTGCCGATATCGTGATCGACGCGAGTGGAGCGGAGCCCTGCATCCAGACAGCCGTCTACGTCGCACGCAA
CGGTGGCACGTTCACACAGGGAGGCATGGGCAAGACCGACATCATGTTCCCTATTGGCATCATGTGCGGCAAGGAGCTACACGTGACCGGCAGCTTCCGG
TACTCTGCAGGCGACTACCAGCTTGCACTCGACATGATTGCTAGTGGGCGGCTGAGCGTTAAGGAGCTGATCTCGGAGACCGTGCCGTTCGAGGAAGCCA
AGGAGGCTTTCGAGAATGTCAAGCGTGGCAACGGCATCAAGTGGCTTATTGAAGGGCCTAGGAACTGATGAGAGAATGTTTCGTCCCTGAAAGATGGTTT
AGTGACAGAGGTTGGGCATTGTGAAGCAAATTTTGTTGCTGTAATTCATTCTGTTGTGGCTGTTGCTTCTTCAATCTCGGCAGACTGCAGTGATTGACCA
TGAGCTGGGCAGAATGCCCATAAATGATCACCCTTCTTTTGTCTTCGTTTTATGAAAATGAAGATTGAAAATGAAGCCCGACTTTCTTCTTTTTGGTCTT
ATCATATAAGCATCCTGAAACGTCTTACTTGGTATTCTGAAAGCCTCTAATAGAGGCTTTCACCGATGAGCGCAAAAAAGCGGTATAAAAGTTCGCAAGA
CGAAACTTGTTGTCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCGCCGTATCTTGTTATCATTCGTTAGTGCCGGCTTGATAAACCTAGTTTCGTCGCGTTACAACCCCTTCT
TTTACTGCCTGTCTTATCAGATGCCTGGAGAGACCAGAGCCCTCCGGCACACGCCTTTCAACCGCTGTATCCTCGATAGGAACACACTTCAGTTTGTCAT
GTAATTCGTCTCGATTCTTCCGCTTTCTGCCGCTGTTCTTCTTAATCCGGCTAAACCACGCACCCCCCCCCTCACGACACCAGCGGTCACTGCAGAGCTG
TACCGCTTCCAAATTAACCTCACGGTGTCCGGATGTCGGCTCATAAGAACACCAACTTTAGCAAACGCTCCACGGGGTACTTCTTCATTGTTGCTGATCT
TTAGAAGCTCGTCAATGACGGTTTTGCGCCCGGTGTCGGTAAGGTTGGACTTTGGCATGCTTGAAGAGGGAGAAGCAGCGTAGCGCAGGCGTGGCGGGTC
GCACTCCAGGCGAGGCGGAAGACCTTAAGAGCTAAAAATGAAATGGCAGAGGCTACAGTAGTTCGTTCGGCACAAAACTGGTGACTAGAAAAAGAGGAGA
TGCGGGACTTTTGTTTTGTCCAATCAGATGCTGCGATGGTTAAATAAAGATGAAGCAATTGGTCAAATTGTCGGTTTCGCGTGATCATTTCCGACCAGAG
GAAGTATACCATAAGGGATGACAGGTATTCTCAATACGTCTTTGGCAGCTCTCAATTTTATTCGTGGCTTTTCTCAATTTTGACATAAAATGGTGTATTG
CTTTCACGTGATTTCTGTTTGTGTCCGAAGTAAGATACTTGGCGTGTCGTACATTGATATCTCATATCTGGTCCACAACCCATGCAAACTAGGTTAATGA
CTTCGGTAAACTACGGTAGATGAATTAATTTTTTCTGGTGAGTGTCGTCCAAACAAATTTGCTCTGTTTGTACAGGGAGCAAACCCTTTCTTTAATTTGA
AATGTTGTCTGAAAATTCAATTTCTACGGAAAACGTATAAATCTTACACTTTGTATGGAATTCTTCGTGCAGAATGCAAAGCCTAGATTAGAACGGCCAA
TGTGCAGGAGATCATGGTAAAGGCCTGTGAAGGCTGGATCAAAACAAATCGTGCCTCGATATGCTGTGGGTGACCAANNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACGAAAGGATGTGTTGTTGAACAACATGGCCCGGTGCGTACTGTAGAGTGCGCTGGATTTGGT
ATATGAATACTACCAAATCCTGACGCGCGATAGTGACATCATGTTAATGCGGTGAGCACTCCAAGCGGCATGCTTTGGGAGTGGCTCGTCATGCCACAGG
GCCTGTCTAAAGCCCCAGCGACATTCAATCGCTTGGTGACGCAGGTGTTCAGGCCGCTTCAAGCCTATGTACAAACGTACTTCGACGATATATTCGTCCA
TAGCCGTGACGAGGGAGGCAAGACGGTCATGGAGGTGAACTTGGGCCACCTCCGTCAAGTATTGGACGTCATGCGAGCCGACAAGCTCTACGTCAACTTC
AGCAAGTGCGTTTTAGCGTCACCAGAGATCAAAGTTCTCGGTTGCTGCGTCAGCAACGTCGATGTTCGAGCTGACCCCGACATAGTGAGGGCCATTGCAA
CGTGTCCGACACCCAGATCCCAGAAGGATCTCAGGAAGTGGTTGGGTTTGGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN