Description :
From Genome Similarity Track
Location :
Scaffold_299:771- 3037
Transcript NameFunction/comments
Phyag_g4441myosin-like protein

Sequence
2266 bases(100 bases per row)
ATGGTGGCGGGCGCCAAGTGCTTCGTGCCGGACGAGACCCACGTGTGGCTCGCGGCCGAAGTGCTGCGCGATGAGAACTCGGGCGACGGCAAGACCCGCA
AGATCTACTGCAAAGTGGAGCTGCCCGATGGCGAGACCGAGGAGCGCTGCGTGGACAtgttggccaagaagaccaaggcgctgctggacgtgcacCAGCT
CGAGTCGCTCCCCTACCAGAACGAGAACGTGGGGCCTGAGGGCATCGAGGACATGATCACGCTCAACTACCTGCACGAGGCTGCCATTCTGTTCAACATC
AAGAAGCGGTTCCTCTGCGAACTTCCCTACACGTACACGGGCGACATTTGCATCGCTGTCAACCCCTACAAGTGGCTCCCCGACCTCTACGCGGAGGAGC
AACACCTGAGGTATCTCAACCAGCCCAAGGAAGAGCTCCCTCCGCACGTGTACGCCACGTCCGTCGCTGCCTATGACAACATGCGGCGCTCGGAGCGCAA
CCAGTCCATCCTGGTGAGCGGCGAGTCTGGTGCCGGCAAGACGGAGACCACCAAGATCCTCATGAATCACCTGGCCACCATCGCGGGCGGTCTGAACAAC
TCCACCATCAAGAGGATTATCGAGGTGAACCCACTGCTGGAATCCTTCGGTAATGCCAAGACGGTGCGTAACGACAACTCCAGTCGATTCGGCAAGTTCA
CACAACTGCAATTCGACCAGAACGGCACGCTGGTCGGCGCCAAGTGCCGCACgtatctgctggagaagacgcgtGTCATCCAGCACGAAGCCCCTGAGCG
TAACTACCACATCTTCTaccagctgctggactctCCCGACGTCGCATCGGATCTCCTGCTGGACTCGTCAAGGCACTACGTGTACACGGGTGACAACACG
GCACAGAAGATCGAAGGACTTTCAGATGAGaaacacttcaacaagaCACGCGAGGCGCTAGAGCTCGTGGGTCTGTCGCGCGACGACCAGCAGCCGCTGT
TTGAGGTGTTGGCTGGTGTGCTTCACCTCGGTGaagtgcagctgcagtcggaTCCGTCAGATGACGAGAAATCGCTCATCACTGAAGGCGACACTGGCGC
GAACTCTGCTACTCAGATGCTTGGTGTCACGTGGGAGGCGCTTCAGACTGCACTGTGTTCGCGTACCATGCGTGCTGTGAACGATGTGTACAGCGTCCca
ctgaagaaggagctggcaaTGGACTGCCGTGATGCACTTTCCAAGGCCATCTACTCCAATGTGTTCGACTGGCTGGTGGCAACGATTAACCAGTCGCTTG
CCGACGATGCCAACATGGCGAATCATGTTGGTGTGCTCGATATCTTTGGTTTTGAGCACTTCAAGCACAACTCGTTCGAGCAGTTCTGCATTAACTACGC
CAACGAGAAGCTTCAGCAGAAGTTTACGCAGGATGTATTCAAGACCGTGCAGATTGAGTACGAGGAGGAGGGTATCGTTTGGGACCACATTGAGTACGCG
GACAACCAGGACGTGCTCAGTGTTATTGAGTCGCGCATGGGTATCATCTCGCTGTTGAATGAAGAGGTGATGCGACCTAAGGGTAATGAGGAGTCCTTCA
TGTCCAAGGTAACGTCCCTGCACAAGGATGATATGGCGCACGTGATTGAGTTCCCTCGCACGTCCCGCACTGAGTTCCTCATCAAGCACTATGCCGCGCC
TGTCATGTACGACTCGGTGGGCttcctggagaagcacaaggaCTCGTTGCTGCCCGACTTGTCCGAGCTCATGCGTGGTTCATCGAAGCCTTTTATCGCC
AAGCTCTTCGAGCCGAAGCCGGAGCCGAaggcggctgctgcggaggcaCCGGGCCGTGGCCGAaagcgtggtggtgctttgTCCATCACGACTGTCGGCA
CCCAGTTCAAGGAGAGTCTGACGGAGCTGATGGCTACTATCAACTCGACTAGGGTGCACTATGTGCGTTGCATTAAGCCCAACCCGATCAAGAGCGCTAC
GGCCATGGACCAGAACATGGTGGTGTCTCAGCTGCGTTGTGCAGGTGTGATTGAAGCTATTCGTATCTCGCGCGCAGCATACCCAAACCGGTTGCAGCAC
ACGGAGATCCTGGACAAGTTCTGGTTGTTTGTTCCAAGCGGTGGTGATACCGCGGCGGACAAATGCCAACTGCTCATGGACAAACTCAAGTTAGAGTCTC
CCACTCAGTACCAGATGGGTAAGACCCGCGTGTACTTCCAGTTGGGCGTtcttgaagagctcgagg