Description :
From Genome Similarity Track
Location :
Scaffold_1126:771- 2995
Transcript NameFunction/comments
Phyke_g11608hypothetical protein PHYSODRAFT_346539

Sequence
2224 bases(100 bases per row)
CGTCCACTTGGCGAAGTTGCAGGTCTACGATGGAGCGGATGTCTTCGCGTTTCAGGCGGTTAAACAGCACAAGCTCATCGATACGATTGAGGAACTCGGG
CGCATAGTGCGAACGCACAACGTTCATGACTTCCCCTTCAGCCATCGTGCTGGAGGCACCTTCAGGCAGTCCAGCAAGAATCTCCGATCCCAGGTTACTT
GTGAGGATGATTACTGTGTTGCGGAAGTCCACGAGGCGGCCCTGAGAGTCTGTTAGCCGGCCTTCGTCCAGTACCTGCAACAAAATGTTGCTCACATCCC
GGTGAGCTTTCTCGAACTCGTCAAAGAGAACCACCTGGTAAGGACGACGGCGCACGGCTTCTGTAAGGGTACCGCCTTCCTCATAGCCCACATATCCTGG
CGGCGCGCCCACCAAACGACTCACGCTAAACTTTTCCATATACTCGGACATATCGATACGTGTGAGTGCTTGTGGCGTCTGGAAGAGGAACTCCGACAGG
GACTTGGTCAGCTCTGTCTTGCCCACGCCAGTAGGACCCAAGAACATGAACGCACCGAGCGGTCGGTTGTGTGCGTGAAGTCCAGCTCGCGCGAGTCGCA
CACAGTTGCTCACGGCCTTCACAGCCTCTTCTTGGCCGATCACATGCTGATTAATGTGGTCCTCCATCTTTAGTAGGCGCTGCTTCTCTCCTTCCATAAG
CGTCGACGCCGGGATACCAGTGGTCTGTGCCACCACCTCAGCGACGTGGTCAGACGTCACAGCATCTCCCAATGAGGTAttgcgcagcttcatgtccttt
tttgcttcctcctcctcctgctcttcgtgtgCCACCTCGGCCTCTAGCCTCGGGATGACCGAGTGCAGTAACTCACCAGCACGCGCGTAGTTACCAGCAT
TCTGTGCCGCAGTCAACTCACGGCGCGCCTCCTCCAGTTTGCGCTTAGcctgctgcatctcttcCAGTTTGTGCTTCTCTTCGTTCCACTCGTCCATGAG
CTCACTCAGCTCCGCAGAAGCCTTCTCGACCTCCTTCTCCAGGGCAGCCATGCGCTTCTTAGATGCCGAATCCGTTTCCTTCCGCAGCGCTTCAATCTCA
ATCCGTCGCAGAATAATCTCCCGGTCCAATTTGTCAATCGGTTCAGGCTTGCTTTCCTGTTGCAGCCGAAGACGCGATGCCGCTTCATCCATCAAATCAA
TGGCCTTATCAGGCATCTTACGCTCCGTCAGGTATCTGTCAGCCAATGTCGCAGCCGCCACCAGTGCGCTATCTGCAATCCTCACACCATGGTGCACCTC
GTACTTCTCCTTAAGTCCACGCAGGATCGTTACTGTGTCTTCAACACTTGGTTCGGAGATCAACACTGGCTGGAATCTTctcgccaatgctgcatctTTT
TCAATATACTTCCTGTACTCGTCCAGCGTCGTGGCCCCCATGCAGTGCAGAGCTCCTCGTGCCAGTGCTGGCTTGAGCATATTAGCAGCATCTGTGGATC
CTTCATTGCCTCCTGCTCCCACCAACGTATGGAGTTCATCAATGAACAAAATCACGTTGCCTTGACTCTCATCCACATCTTTCAGCACCGCCTTCAGTCT
CTCCTCAAATTCTCCACGGAATTTGGCACCTGCAACGAGTGCCGCGAGGTCCAGAGCTACCActttcttgtccttgagACTTTCTGGGACTTCCCCCTGT
GCGATTCTCTGCGCCAGTCCCTCAGCCACCGCAGTCTTCCCCACGCCTGGTTCTCCGATCAAAATTGGATTGTTCTTGGTGCGTCTGGACAGGATTTGAG
TGGCGCGTCGGATGGAATCTTCCCTACCGATGACGGGGTCCAAATTGCCATTTTTCGCGATCTCCGTCAGGTCGCGGCCGTATTTCTTTAAGCTCTCGCC
CTGAGGGACGTTCTCTGGGTTAATCCAAGGTTGGGACGGAGGTCCCATAGACGCCATACCCCGACGAGCGACGAACAGCCATGGGGACGACGTGCGCAGG
AGAGAGCGACTGCCGACTGCAGTGCGAGAGAGCGACAACATTTCCGCTGCTAATTGCAAAATGAAGTGAGAAAAGGATTGTTGATATGGAAATTTGTAAG
GAATATTCTGGATTTCACGTCTGAAAATTTGTAAGGAATATTCTGGATCTTATGTCTGAAAGTTTGTATGGGATATTCTGGATTTTACGTCTCGATTGAT
TGCCGCAATTGACTTCAAGCACGA