Description :
From Genome Similarity Track
Location :
Scaffold_505:771- 2517
Transcript NameFunction/comments
Physo_145126reverse transcriptase

Sequence
1746 bases(100 bases per row)
CACGATCACGACCCTCGTGATCGTGCTGCATCAACGCACATCCGATTGCGAAGTCGGATGCGTCGCACACAACGTGGAACGGGCGATCTTGGTCGGCCAC
CGCCAAGATCGGCGCCTCCGTCAAGCCCTGTTTGACTGCATCGAAGGCCTGCTGACACTCAGCAGTCCAAACCCACTCGGCGTCCTTCTTCAGGAGCTGT
GACAGCGGGCGTATCATACTTGCACAAGTACGTGGCCAAGCCAAGGAACTGCCACAGTTCCTTGACGTTCGACGGCGTCGGCCACTCATTGATCACTCTG
ACCTTCTCAGGGTCAGGGCGGACACCGTTTTTCCCAACGAGACACCCGAGCACGGGTATCTCGCTCGCCCCGAAGATGCAAGCAGCTTTCGGAGGTGCAC
CTTGTGCTTCTCAACATCGCTCATCCCGTCCGCAGCCCGGCTGTGGACGAACACATCGTCGAAGTAGCTCGGTGCGAAGTCGCGCACCGAGCGCAACAAG
TGCGTCACGCACCTGTTGAAGGTCGCAGGGGCGTTCTTCAGACCCTGCGGCATCACTAGCCACTCCCAGAGCATGCCGCTCGGCGTGCTCACTGCCGTGA
GAGGGATATCGCTCTCACGCATGAGGATCTGATAGAACCCATCGCGCAGATCAAGAGCACTGTAGATAGTGCTCCTGGCCATCGAATCGATGATGACATC
TTTTCGAGGTATCGGTGTCTGCACCGGTATCGTCGCATCGTTCAGCTTGTTGTACGCATGAACGATGCGCCAGCCGCCCTATGGCTTCTTGATACAGAAC
GTCGGAGCACTGTGCGGGAATTTCGATTCCCGCACTTGTCCAGCTTTGCGACGACTCTCAAAGAAGTCGTCGATCGCCTTGACCTGCTCTCGCGGCAGTG
GCCACTGCCGCGTGACACAGTACTTCGTGCCCGATCAATCTCGTGCTGGATGCCCTTGTCCTGCGGAAGCTCCGCAGGGATCTCTTCCGGAAGCACGTCC
GCGTACTCCCGTAAGATCTCGTAGAAGGGACTCGACTTCAGCGAGTCCCAGCTCTGCTCCTCAATGCGCTCCTTCTTCGTCTTCGCACTGAGAGTGTCCT
CACTCTCAGTGGTGCTGTCCATGAAGAACTGCCTCAGTTCTTCATTCTTGCTCTTCGTTCTCTCGGCGTCCGAGAGAATGCAAATTTGCTCGATGCGTCC
ATCGTGCAAGTCACGCGCGAAGCGCTTCCAGCTCATGACTGGAAGCGAAGTCAACTCCGACGCTTGCGTCGGAGGGTTAGCGAGAGTCATCTCCCTGTAC
CGGAATCCGGCACGGGTACCAGCGTCAACGTCTCGACGCCTGGCTTCTCAACCTTCGTCTGCCCGGCAGACATTTCTTGTAGCGTCTCGGCCCCGGGCCG
AGACTTGCGCAGCGACCTTCGCATGCACCGTCTTCTTGTTCTGCGGAACCCGGCTCCGCTTGGTTCTTGACCTCGTCCAGGCCCAGCCGTGGACGGGTGT
TCTTATGTAGTACCGCCGGCAAATACAGTCCGCGGGCAAGCGACTTCAAGCCCGGCTTGGTCGCCCGGCGCTTCGTCGTGCAGCCCGGCTGCACGACAGC
ATGCGAGTTTTTCCGGTGCGGGACGTTTGCAACCGTTCGCACCGCCTGCAGTGTCGGCTCCCGGAGCCGACACGCCATCTTCACCTCGACGCCTGTTATT
GGCGGAGCCCTCCATTATGGAGGGTGCGTCGGCTCCCCGAGCCGAC