Description :
From Genome Similarity Track
Location :
Scaffold_92:77081- 78385
Sequence
1304 bases(100 bases per row)
GGAAACCTgactgcgtctgcaacacACCTTGTGCGTGCAGACTGCCCCCACCTGTCGGACTCAGAGTGGGAGGCGCTCCAACGACTGTCAACAGTCATTG
GCGAGGTGGCTGTactggcgatgctgcgcacgctATCACCGACAGATTAACACGGTGTTGTTCTGGGCTTTATCGTGAAGGGGGAgtgagatgctgctgc
ctctacgacggcgtcgtccccGACGACACCACAATCGATATCACGTGAGCAATTACGTGGGAAAACAGGGCGAACCTCTTCTCCGTTAGCCTGTCGAAGT
CGACACAGCCATTACGGCTCGACGTATCGTCGAGCCGTTGTCGAAGGTTGCGTTCGCCATGTCGTGCCTTGGCGGACGAGCAAGGAGTTGGGCGTACGGA
CGCCGACTCACAGACCCTACGTACTTCAGCACACACGATGATTTCAAGCAGGAGATCAGACGAGCGTTCGAGCCCCCGCAAAGCGAGTTCCGATCGAGGG
CAAAGttcctcgatctgcagcaggacaaGCATCGCGTTCACGCTTACGCCCAAAGAGCACGGTACTTGATCTCGAACATCCTGACCAACCCGATAGACGA
GGCGACACAAggtcgtcacgttcatgaaaGGCTTGAAAGATGGGCCGGCCAAGACCTATCTCTTCCGAGAGTACCCAAGTACTCTCGAGGCTGTGATCAC
GTTCACAATGTAACAAGGGTTTAGCCTGCGGCAGGCTAAACTGGATGTGAACGTGACACGGATGCCACATCCGATGGTAAGGACGGGAGGCCCAGAGCCA
ATTGACCTCTCGAACGCGACGGCTGGGAATAATACACCGCGTCGCGGGGCTGACGTACGATGCATCCGTTGCGGACGCATCGGTCATTTTGCGCAcgagt
gcacagcacctgTGCACAGGCAGAGAAgccaacgtggcgatgcagggTATCGCCGCGATCAATCAAGAAACACGCGGAACCAGTAGGCGCGGGGCGCCCT
ACTGGCAATGCAGTCACGCGTGTCGACATTGGACACACGTCAATGAGGGCTGTGGCTCCCAGTGAGAGGCGGTCTCACTGCAACAGGCGAGATGACAAGC
CCAACCttgtcatcctggacgtgacTTCGAAGAGAGTGGACCCTCTTCGTGCATTGGTAGACTCAGGTGCGTCGAACAACTTTATTCGACAGCAAAGTCT
ATCAAGCGttgacttcgaggaggtgcaaaCACCTCGAAGCATATTAGAAGTACGCCTGGCAACaggtgccgtcgtgaagACTGAGAAGCGTGTCGTACGC
GTAC