Description :
From Genome Similarity Track
Location :
contig_13:770738- 775076
Transcript NameFunction/comments
g2506.t1hypothetical protein

Sequence
4338 bases(100 bases per row)
AGCTTCTACCTCCTCGACGTCGCGCTGGTCCTTGGTCATGAGCAGCTGCAGCGTAGCGTCCTTGAGGTCCATCAGCCGCAGCAGCTTGTCCCGCGCCAGT
TTCACGTCCCCGGAGCTCTCGAAGCGGTCGCTCACCTCCCGCACCACGTACCGCTGCAGCTCCTCGCTCAGATTCAGCAGCTTCTTGGCGTGGGGCTCAA
ACCCGCCGTCCTCGTGCAGGTCCATCCAATTGAACAGCTTCACCAGTAACCAGCATGCATTGGAGGGCGATGCAGCGAGGAAATCCCGCGCCTTCTTGCC
ACCAAACTGTCGGTTCGGGACCACCTTGTCGTGCCAGAACCGAGCACCATCGATAGCCTCCATTTCGTGCTTCAAGGACGCAAGTGCAGAGCTGCTGTCG
TCTGCAATCGCCCCATTGGGGACAAATACAATGCCGTTTCTTCGGAGCGCTAGTTTGGGCTTGTCTCTAGGCTGGAACGGGTTGAGCAGTGCAACGAGTT
TGCTTCTGGCCAATTCCACGCGCTTCTCCAATTTCTCCCGGTCCTCTGGTTCCATGCGCTCGATCAACTGCATCACCTTGGGCGGTGTTGCAACGCGCCT
GTTGAGCACCACGTTCCAGTACTCCACCTTTTGCTCCCGTTTGTCGTAGTCGATGACCCAGGCATACTGCGTGATACGGTTGAACTCGATCGTTTGCAAG
TACAGCAAGCGTGCCTTCCGGACAGCATTCTGCAAGATCTGCCTGAGTTTCACTTGTAAATCTTGCGTGATATTCAGTGCTACTCGTCCAGGTGGCTCGT
ATGGCTGTCGTAAAGCTTCGTCGTAGGGCTCGATATCCTCCCAACGAACCACTGCAGACCGATTGGCGAGAGGGACGAAGACCAACACGCTCCCAGTAAG
CATCAGGTTCTGTGTCGACACGATCGATCCCACGCAGTTCTTCCACTCGCCCTTCAGGATCTTCACCTGGGCGTCGTAGTCACACCAGGTTCTAACAGAC
TCTAGCACCCGAGCCTTTTGTCTCTTGCTCCAGCGCTTTTTCTGGTTAGCCTTGTCTGTTGGTCGTCGTTGAAAGAACAGGGTGCGTTTAATGTCGTCAA
TCCGCTCCTGTCGTGCTGCCATCTCTCGCTTTGTGTCTGACTTCAACGCTGGCGATACCCCAAATGCAGCTTTCGCTTTGTACACGATGGATGCACGCAC
CCTGTCGTCTTTCTTCCGTTGTGCTCGCGCAGCTTGTGTTTGCCTCACTAGCTTCATGTATGCCTTTCCAGACTGACGCGCAACAAATGACCGAATAAGT
GCCTGCATTGTCGTGGCAGCAAGGTGTTGCCGCTGTAGCTCTGCTTCTTGCTGCCTCCTCTCCTTCTCACGCTCTTTCTTTCGCCTCTCTCGCTCTTTCT
CGGCGTCGACATCCCGTTTAAGCTCTGCTTTCTGCCGTAAGATGGAGAAATAGTTCAGCCGGCGACAATGGTGATATTGCCTCTGTCCTTTGGCATGGTA
TGAGCTCATACAACGCTTGCAAAAGACGTCCAAGCATGTTTCGCAAGCCCATTGAGCAACCCGGTCGGAGCACTCAGCGCACATGACCACCAATGTTTGA
AACTTGTGTTGACTTTCCACTGGTTGATCTGTAAGCGATTTGCTTCCTCCTTGGTGAGTGATCCCTGGACTTCTCGTTTCGGTTGTTTAGATGGTTGCTT
GTGCACATGTGGAAAACATGAATCACAGAACGGGGCTTTTCCATTGCCGCATTGAGGCACTCCCTCGTCGCTGTCTCCAATCGACAGTAGTACACTTTGA
ATTTGTCGTCGCTGGTGACGTTGAAAAGCTTGTCGTGCTGTATGATCCCTATCAAAGCAGACTTGGCACATAGCATCTTCACACTCCACGCAATACACTT
CGGCAGGAACGTTTGAGGCGCTTGGATTCGTGCTGTCTTCGTGACGTTCACAAACGCGTGAAATTCTTCTCCGGGGAATGGCAACGGGACGATCTTGCCG
CATTTAACTCCCTTCAAGAAAAGCGGGCGCTTCGTGAGGATTTTTACCAATGTGTTGGAACCTAACTGTGCGGCCGGTGTGATCAACGAATCAATAAACA
TACTCGCGAGCATCTCCTTCAACTGCAAGCAAAACTTGTAGCAGCGATACGCTAGCTGAATCGTAGAGGCACATTTGCTACGATGCTTGTGCAAAAGGAT
TACGAATTTGTCGTGCCTGTTCTTGGTTGCAATTCTTACCGCAAACCGCCGTAATACTGTAACAGACCACAGCAACCGCTTAGTGTGTGCCTCTAACATT
TTGTATTTTCCGTTCTGAATGGTTGACGGAAGTACAAAGCGGTTCATGAACCGGAGAAATCGCTCGAGTTCACTACCAGTATCGACGGGTTCTGAGCCTT
TTTTGGCTTCCTTGGTTGGTGTCCACAAACCTTTCTTTCAGCAACATCAAAATTGCCTGGTTAAATCTCTGGAATGAGATGGTCTTTGCTTTTGGTTCCT
TCATCTTCGCGAAAATCACATCAGCGTTCTGCATTGGAAACTGGGTCCTGTGAATAAAGGCGTGGGGTAGTGACTTGAGAAATCTCGCAAAATGAGAATT
ATCCATCTCCGACGAGTTCCCAGAGGCATTTCGAAAGATTTCCTGCCAAATTCCATCATAGCCTTTTCGTTTCCACTCTCTTTTCGCAAAGTTCACAACG
TACAAGACCGATCAACACGAATTTCCTCCAGTGCATCCCTCTCTTTCTCATCTGCCACCTTCAGCGCTTTGAAGCAAAAACTTTGCAGCAATAACTCATC
CTTAACTCGACTGCGAGTCTTCTCCTCAAGGACCTTGCCTACTGCACCCTCCTCCGCCAGAAACTGTCGCCGGCGAACTACTGTAGACAGCATCCTTCTT
CCGATGAACTTCCTCGCTGCTCGTTGTAAAATAGCTGCATTGAGTGCACGGAACCGCTGGTTCTCTAGGTTTCGTCTAGCTTTCCAGCGTGCTTGAATCC
TGTTGATCATTTTGAGGGCATATCTCATTTTCAAGAGCTGTATTCGAGTTTTGTATCCTCTCCACACGCGTTGGATTCGCTCAGCACTTCTTTCCTCTAT
CAGTTCCCACGCATAGGCACGTCCTCTTATTCCTCGAACACGCTTCTGAATACAAACCGCCGCAAGTCTTCGCTTGCGATTGACCTGACGTCTTGATCTC
TCTATTTCCTTAGCTTTTTCGTAACGAAGACGCTTGCGGATTTGTTTTCCTCTCCACCGGGCCTGCAATTTCCTAGCAGCCTGGACTTCTCGCGAGTTGG
ATGGATCACCAGGCTGAAGCACAGTAGCTGCTTTCAACAGCGAAAATTGATTCCACTTCTTCTGTAAATGTATCGGAACGAGGGCATTAGATTTCCTGTT
TCGACGATCTTCTTCGATTTCATTCAAAAGATGATTACGTTGAGCAAGAGCTTGCTTCTTTCGCCGCCAGAGCTCACATCTAGCAAGAAAGCACCTCCAT
GAGCACTGAAGAGTAGCAATTGCTTTACTAATGTCGCGTTTGTGCTTGGTTACCCATCTGCGTCCTTGTTGGCCTCGATAATGAGCTTGAACCGTAAGTA
TTTTTTCTTGTCGCGCTCAAAGGCAGCGCGTCGGCGACGAAGTATTAAAACTTTCTTTTGTTGCCAATTGCGAAATGCACGCTGAATAAAAATTGCCGCT
CCAACCATTTTTGTGTTTTTTGCCCAACCTGCAACTGTAACAGCTTTTTGGCGACGACGCTTTTCGATGCAATCAATCTTACTCAGTAGAACTCGTCTGC
GCTGAGCTAATATCCGCCTCACATACTTCTGAATGACGACAGCAGCGTTAGTTTGTCGTTGCCTGTGTAGCTCCCGACGTAGTGCTGCCCACTGAGTGCA
TAATTTTCTCCAGAAACTTTGAATACAGACAGCAGCTTTTTCTCGTGTTGCTGCTCGCTCACGCGAATGCCGGAAAACATAATTTCGTACGCAACGCGTT
ATCCTGCAAGCCGCTTGCTGCTCCTTGCTTGCAAGTAGGGCAAGAAAGGCTTCTTGTCTACGTTGCAATTCATTTCGGATTCTTCTTCGTGTAGAAACTT
CACGCTTAGCACATATTTGCCGCCACCAGCATTGTAAGCGGATGCTGGGATACTCCCACTCCTGTTCTTGCATTGAAAGGACAAACCCTTTCCAATGACG
CATTCCTAGGAAGAGTAGTTGATTTTGTAGGCGACTCCAACACGAAATAAAACTTCAGTAGCTCGTTGTGGGCTGGCGACGAGAACTTCCCGAACCCAAG
CGCGTAAATAACATCAGAGGAATCCACTGTTTTATCTC