Description :
From Genome Similarity Track
Location :
Scaffold_517:7706- 10386
Sequence
2680 bases(100 bases per row)
TATGGCTTAAGCAAGCCAACGTAAAACACTGGGTGTGTGCGCAATTTGCGCGGAAGATTGATTGTACAGGCAAGGTCTTTCTTAGCAATGACCGTGAATG
GCCCAATGAAGCGCGGACGCAATTTTGGCTTGAAGACGGCAGACACTACATTTAAAGGTTGGTTCCTAGCATTTAATAAGACTTGGTATCCGACTTCATA
AGAATCAATAGATTCTCCAACCTTAGCATGAGCTTGTTCTTTTTGTTTGTCTTGGCTATCAGCCATTGCATCACGCACATGTCGTAAGACACTAAAGCGC
GTCGCGAGAAACTCTCTCACTTGTTCCTGCATCGTGGTAGGGCTGATTTCAGCAAGCTTGTCAGCAGACCCTCCCCCATCAAACCCAGAACCACGGAGTG
GTAACGTGAGTGGAACGCGGGAATGCGTAAGGCTATTCACATAGAATGAATTAAAGCTGGTCGAGGCATGAACAGCGTTGTTCAACGAAACTCAATGTCA
GGGAGCATCGAGCTTCAAGTCTTAGGCGGATCAGCACAAACACTGCGAAGAACGTCACCAATGACGCGATTAACTCGCTCAGTCTGACTATCGGTCAGCG
GATGATCCTCTGTGGACATGTTCAATCGTGTGCCAATCACCTTAAAGAAGGAAGTCCAAGACTTGCCTGTGAAGCGAGGATCTTAATCAGAGATGATTAC
CAGAGGCAATCCGTGTTGACGAAACACACGATCGATAAACAGCATACCTGTACCTTTGCCATCGATGGAATCTGGCACTGCCGCTAAGTGAACCATCTTA
CTCAAACGGTCAACAAAGAGCACAATCTTAATTTTCCGTCACAGTCTTTGGGAAGACCAAACGCAAAATCCCTACTGATAGACTCCCAAAACCAAGTAGG
TACGGGTAAACTGACGAGTGGCGCAGCCGATTGTGCCGAAGGTTTGACCCGCTGGCACGTTTCGCATGTACGCACGTATGTGCTTACCCATTTGTAGATT
TTGGGCCACCAGTAGTGTTGACTCACAAAGCCATAAGTCTTTTCCCGGCCCAAATGTCCACTGAGGGCAGTATCATGGGCCTCAAAGAGGATTCGATACT
TTAAATCCTCATTGTGAGGTACAACAATGCGAGCGGAATCCGCTACATCTGTGCGATAGCACAAGAGACCATTATCGATGAAATATCGATGTAGGCTGGT
ACGCATGCGTGCCGATAATTGACTGTCCGAGTCCTTGTATTTCTCACTCGCAAGGGCATAAAACAAATGCCACACATTGAGGATCCTGTGGATCTACCAC
AAGTCTGAACTCTTCAAGAGAAGACGGCAAGGTCGTGACATGATCAAGCTCATAATCGGGACGGAGATATAAGACATCGGCCAACACAGTTTTTTTCAGG
TTTTTACTTCACCTCGAATTTATATTCCGCAAAGATGAAAAGCCAACAACCCATTCTATGAGAGAGGTAGGGCAACTGTGTCTCCGTGCGTAACAATGCA
TGATCCGTGTAAATGAAGCATGTCTTGGAGCCAAGCAGACGGACTCTAAATCTAACGAATGTGTACTTCATAGCAAGTAGCTCTTTGTCATGAACGGGAT
AGTTTTATTTCCAGCAGATTTCAGCTGACGAGATTCGAATGCGATAACTCGCAAGTGACCTGCAGCATCTGTTTGTAACAGGACGCTACCTTATCAAAGT
AGGGTGCATCACAGACAACACTAAAAGAGTAATCAGGATTTGGCAACGTCAAAATGGGAGCATGAAGGAGACTCTCTATAATTGCCCGAAATGAGTCAGC
ATGGGTGTTGTCCCAGCGCCAATCTGTGTCCTTCTTCAGAAGATATGTAATGGCCGAGCCATATCAGCGTAATTTTCACTGTATTTGTGTAAGTAATTGA
CAAGGCCAAGCCACTTACGCAAGTCTTTTTAATTTTTAAGAATTAGCCGGTCAACTATAGTCTTGACCTTAGCGGGATCCGCCCTAAGGCCGCGCTTACC
AATGCAACATCCTAGAAAATGAATCTCATCTGCACCGAAAATGCATGTAGACGCGTTGGCGTACAATTTATTAGCGCGCATGCACTCTAGCACAGCTCGC
AAATGACCGATATGATTGTCAACATCTGACCGACCTTATTCGGCGCGACTATGGACAAAAATGTCATCAAAGTACGTCTGTGCGTAATCCCGATGTGGGC
GGAAACGTTTCGTCACCAGACGATTAAAGGTAGCCGGCGCGTTTGATAGCCCTTGGGGCATCACCAGCCATTCCCATAGCACACCACTCGGGGTGCTCAC
GTCTGTCAGCGGAATCTCACTCGCTCGCATGATCAATTAGTAATTTTTATCGACTAAGTCGAGTGCGCTATACATAGTACAGCCAACCATGTTGTTTTAT
AGGACATACTTTCGAGGAATGGGTGTTTGTGCCGGAATAGTAGCCTCATTAAGCTTGTTGTAAGCATGCACAATATGCCACTTGCCGTTCGGCGTTTTTA
CACAAATTGTCAGTGTCGAATGTGAAGATTTATTATCACGTACCATTCCTGTCTCGCGCTTGGCACGGAAGAAGTATCAATGACATCACATTGCTCCTTA
GGCAAGGGCCACTGTCGTGTGACACAGTATTTAGTCCCAGGAACTAGGTCAATTTCATGACGGACACCTCTATCTGGAGG