Description :
From Genome Similarity Track
Location :
Scaffold_64:77049- 80690
Transcript NameFunction/comments
Albla_Nc14052940hypothetical protein SELMODRAFT_145748
Albla_Nc14052950protein kinase putative

Sequence
3641 bases(100 bases per row)
GCTGCAATGTATCCGAGAGAAAATGGACATTATTGATATCGAAGACGATAATATCGACGCGGAAGTGCTCGACGCAATGGCTGTAACACAAGCGCATTAC
AAGTTTGCGTTGGGAGTATCGAATCCATCTTCTCTGCGTGAAACAACAGTCGAAGTACCCAACGTCACATGGAACGATATCGGAGGACTCGACGACGTGA
AGACCGAACTTCGGGAGCTTGTTCAGTATCCCGTGGAACATCCCGAGAAGTTTGAGAAATACGGACTCAGTCCGTCTCGTGGAGTCTTATTCTACGGTCC
TCCAGGTTGCGGGAAGACTCTTTTGGCGAAAGCTGTTGCAAACGAGTGCCAAGCCAACTTCATTTCTGTCAAAGGACCAGAACTTCTAACAATGTGGTTT
GGAGAATCCGAAGCCAATGTCCGCGAAGTCTTCGACAAAGCTCGATCTGCAGCTCCTTGTGTGCTCTTCTTTGATGAACTCGACTCCATCGCCCAACATC
GAGGAAGTGGCGCTGGCGACGCTGGTGGTGCCGGTGATCGTGTGATGAATCAATTGCTAACTGAAATGGACGGAATGGGCGCCAAGAAGAATGTCTTTAT
CATCGGAGCAACGAATCGTCCTGATATCATCGATCCCGCACTGATGCGTCCTGGACGACTCGACCAGCTCATTTTCATCCCAATGCCGGATTTCGAGTCT
CGACTTTGCATCCTTCGAGCTGTCTTACGCAAGAGTCCGGTGTCCAAAGATGTGGATTTGAATTTCCTCGCACAGAAAACCGACAAGTTCACCGGCGCCG
ATCTCACTGAAATCTGTCAGCGAGCTGCGAAATTGGCCATTCGAGAAAGCATTATGAGAGATATGGAACGCGATCGTCTCCGTGCCGAAGCGGGAGACGA
TATGGAAGATGTGGAAGAGGATGATCCAGTCCCGGAAATCACACCTCGGCACTTTGAAGAAGCAGTTCGGAATGCGCGACATTCGGTGAGTGATCGAGAT
TTGGCACAGTATTCCACATTTGCGCAAACGCTTCAGCAAGCGCGCTCCCATGTCTCCGCAAGTGGAAGTTCTTTGGCGAATTTCTCATTTCCAAATCGCA
GTATCTCAAGCACCAGTGGACCCGCCGAGGAAGATGAGGAAGATCTCTACAGCTGATAGTCAAGAAAAGGTGTTTTATGCTTACGCAATATAGCTATCAT
GTCTCCTATCTTCTACGTCACCTTCATCCTTCGCATTTTAGACTCATTTTACAAAGAGGTTGCCATCATCAAAGCTCTTCCTGCAGGATTTTACGCAGTT
CGTAGGAGACGTGAATGGCTCCAGGTCGCTCGGATGGATGGAACGCCAAACAAGCTTCTGCCAATTTCACGATGGAAGCCGGGCATGATGCAGAGAACGA
AGGCTTTAGCTGTCCGGAAGATACCAACTGTAAAATGGTGACATCCTGCATCTTGGAGCCATTCGTGTTGACTGCGTCATGGAACGGATTCTTACATGTG
TCCAATTCTGTCAGCACCACACCCAACGAGTACACATCGGCTAGTTCGGTGTAATGACCACCGAAAATGACTTCAGGAGCGATCCATCGAGCAGTTCCAA
CACCGGCTGTCATGGTGTCTTCCAAAGATCGATTCCTGGAGATCCCGAAATCGCTCAGCTTTGCGCCCTGTTGTGCATCCACGAGAACGTTCCGAGACTT
GAGATCGCGATGGATGATTTTCGGATTCATTGTGTGCATATACACGAGCGCATCGGCGATATCGATGGCGATCTGGCACTTGAGATTCGCCCACGTGAGT
GAGGAACCTTTACGGGAATTCAAGAGACTTCGTAAATCCCCGCAATCCATGTACTCTGTGACGGCTTGGATAGTCAATGCGGTCGACCAGGCAACGCCAA
TGAATCGGACGATCTTTGGGTGTTCTAACTTCGCCATCACTTTGACCTCCGATGCAAAGGCTAACGCATCGCTCATCGTCTTCTTGTCGGAAAGAAGACG
CTTCACTGCGACTTCTTCATTCATGTAGCTTCCAAGCCACACTTCGCCAAAGCCTCCACGAGATAACAGCTTCACCAGTCGGACATCCTTGTAATCCACC
CGTACTGCTAGCAACTCGGAATCGGTCCAGATACTCGATGACCCGTGAGTCTCGCCGGAGACGCCTCCGCTTCCGTCTCGAAGCATATCTTCTGTGAGAT
CGGTGTCAAAGCGATTATTTCCCTTGGTCGAATACTTTTCTTGACGACTTCGTCGACGCCAATACACGTATGAGCATGCAATGAGTAGGATTCCCACTGC
GCCTAGCACAAGCCCAACGATGAGCCCGGTCGATGAGGAGGTCGAACTTGCATCTGCGGCTCCAAACACACATACTTTTCCATTACGCGACTCTGTGGCT
CCATACCCTTGATCACAACGCCCGGAGAATGCCATATCCACGTCAAAAGTCGACAGAGACTCCAAAAATGCGAATTGTTCCGGTGTTAATTTCACATTAG
ACAGTCGACAGGCTTTCATCCGAAGCTCTTTCAAAGCATTCGACAGGAATATAACTGGAGGGATGAATTCCATCGGGTTGCCGGAAAGCGTGCTACAGGC
TGGAACATGAGTAATAGCCGTGGAACGAGAGTGGAGACGTACAGATTCTCCAGCTTGGAGGGAAGCGGACTGGTGAAATTGGCTAGATTGTTCTCGGCTA
GATTGAGTGTGGTCAATGACTTGAGACTCTGATACATTTGGCTTGATTCCGAGGGGAAGGAGGCGAGGTAGTTTTGAGATACATCGCTGAGATGACACGA
GTTAGTATACGAAGGATGTCAAGTTGGGTGACGTACAGATACGTAAGGGAGCAATTCATAATCTGTTTGGGAAGAGTTTGTAGATTCACATTGACCAGGT
ACAGATGAGTCAGTGTTGGAGGGAAAGTCACATCCGACTGATCTAAAAAGGCTCGGAGATTGATGTGCATTCCAATGCTGAGGAATCGCTTAGTAAGAGG
ATGGAGAGAGGCTTTGTGACGTACAATTGAAGTACAGTTGTCGGCTGGTTGGAGAAGAAGGAAGGCTCCAATCGGACATTTTGCATGACTCCTTTGGTTC
CCATTGTGGGGCCTCCATTCAATTGCCTGATTGTACAGAGTAAGGAGAGGAATAGCCGAAGGAATAAGACGTACACAGAAACGATAGAAGGATCGAATCG
TAGTTTTTGAATTACTGTGACGTACGCCTGTGTCATTGTATCACTTTGCTTTATGTATCCGGTCGATAAGAACCAGCTATCTTGTGCATTGACCATCGAG
TCCAAACATTGATATGTGAGTTCACACGATCCCGACTCGGTTTCGTAGCTAGTATCAAACAGACAAGAGCCAGATGCACCCGTGTTTCTGCATGGAAGTC
GGGCGCGTAGGGAAGGAGCGTATAAGACACACGGATTGTTGAGGCAATTGGCTGGGCAATTCTCACTAGTCAATATATTTTGTGTGATTGATGTGCATTC
AGCCGCATCACACGCTGAATAACGCACACACGCGATCACAAATAGACGCACAGTGAGGGAGCAACGCAGCCTTTCCATTGAGCTCTGCAAGAACGCTTAT
AATTGGTATTTATATTATAGAGTCCGTACACTTTTTTCTCA