Description :
From Genome Similarity Track
Location :
Scaffold_1287:7704- 11249
Transcript NameFunction/comments
Phyta_totarag12633hypothetical protein

Sequence
3545 bases(100 bases per row)
TGCCAGCACCGGCTGGCTCAGCGGCCGAGGCAAGACCGCCGTGGGTGCCTTGTACTGCGGTCGTTCGACGGCGGGCCCTTGgggttctgcagcagcttgg
aggtcgtcatcttcgtcggtgGTCGCCTGGTACGCGAGGTTCTGCTATTCGGCGTACTTCCGCGACCCTACGGAGGCGTATCCCGGTAAACGTGGTACGC
GATCTCCAGCCAGCCACATCCCGATATGCGTGCTCTGACCTAGCACTAACTTGCGACTGCTCACGTTTGTCAACTCCAGATAGAGCGTCCTGTCTGGGCA
AGTCGTTAGTGTAGGCATACATCGGTCCCCACGGGTCAACCACACCTTCTGTCGCTCGGTTTTGTTCGGATGTAGCTTCACTTCCAACGATCTCCCGACC
TCGATGTAGAGAGCTTCCCTCAAGATCACCGGCTTAACGCGATCCCCATAGAGCGGACGCCTGCCGGACAGTTGGATACGCACTTCATCGGGAATACAAA
TCGTGCCGTCAGCGAGATCAAGGCGAATTCCAGCGGGGGCCATGAAGTCCATACCGATAATTACGTCTTGTCCACTGGTAGGTGGGCCCACCCACGCATC
GAAAAAGTAGATCAATGATCCAGCGAGAGTGATCTTAAGTCTGGTACGCCCATCCGCAATATATGGAGTTTTCCCAACACCTTCACGCTCCAATGTCTGA
CTTTCGTCAATGTAGCACCCAACCTTACGACCAAATGCGGTGTCGATGATAGACACCTCGGCGCCACTGTCAAACAGCATGGTTGCTTTTTCGTTGTTGA
TCTTCCCCATGGCTTTCGCTTGTTTGAACTTCTTGTCAGGCACGTGGTACTTCCAGTAACCACGCGACCCTCCTGGCAAAATGTCCAAAGCCATCATCAC
CTTCGATCTTGAATATTCATCGATCTTGTGAAGACTTGATACGGCGGAGGGTAGGTTTTCCATGAAGATCACATGTATTGTCGCTCGGGTTCATCAGCTT
GCTAACTGTTGACTCCTCTTATTTTTCGACATATGCATAGACACAATATCTAGAACGCTCGTCTCGTACCGGGTTCAAAACCGGCGAGCGTCCTAGTTTA
ACATCTTTTCGGCCGTTTCCGGCAGCATGCCTGCGTGCTTGGTGGGGTTGAACCACTGACGGATCAAGTTGTAAAACTCTTCCATCGGGCACTTGTCGGC
ATCGTGGATTTCCCGCACGCCTtgcacacgaagaagcagcgctcAGACGGATGCCCTCTCTTGCCGCACTTCTCGCAGGTCAAGCGTCCCCAGCACCCAA
GGTCGGTGTGTTTGCGCGATCCGCAGTGAAAACAGCGTTTGGGTGGCGTCCCTTCATCTGTCGATCTCGGGTGGCGATCACGAGTCGCGTAACTTGAACG
CTCACGATCTTGATCCGGCGGTCCCCGATCTTGCGGCTCTCCACGACCTCCAGTCGCTGCCAAGTATACCTTGCGCAATCCGGCTTCGCCATCGGACCCG
CTTAACACAGCTTCAGattcgctgctgtcgttggcCACGTGGATCGCTCGGACAGCTCTAGTGGCCGAGGGGCCGGCTGCACCTGGGGTCTTTGATCTAG
ATTTGATTGATCCATAGACCGTCTTGGTCTGCCGCGCCTTCGCACGTTGTCGAGATCGCAGTGTATCTTCCAGGGTATCAGCGTCTGGAatccgcagcag
cgccaggtGGTCAGCCAGATCGCGGTCATCGAGAGTCTCGATGAAGTGATCGACATGCTCGCGGCGGACTTCCGGAGATCCATCTCTGACCTGGAGCCGC
GTGCGTAGGCCAGCCACATTGAGACGATGCAAGTACTCCAGAGGTGTCTCATCCGAACGTTTCTTGGCGTGGTAATACTGTCTCGCAACAGATACACCAT
GACCACAGTACTGCTTctggaagctctggagcAAGTCCTTCCAAGTGCTGCGCGTCGTGCGACTTTGTTGTCGGTACCAGTTTCGGGCTGGTTCGGTGAG
AAGATCGCCGAAAACCAAGCACTTCTCTTCATCGGGTGCTTGATCTCGGATAAATGCTGATTTCACCTTGCCGAGCCAAGATCGAGCTCGATCTTCGTCA
GCATTTTTTTCGGCGAACGCCTTCGGCTCCAACATCGCCGATACACGGATGCGAGGAGCAGGTGTCGGTTTTCCGGCAGTCGCCGTCGAGGCCACTACTG
CTGGTGCGGTCGtgtcaagatcaagatcgtTGGGATCATACTCCCATGGCGAGGAGTGGTGGTCTGGTGACCCAACCGACTCCATTTCCacatcttgatc
tccagtcggCCTTGTACTTCGAGGGTTGGGAGGCGACTGTTGCTCTTTCAGAAAGCGTCCCATCGCCGCTTGGAAATATGACTCCAGCCTCTCAGGCGAG
TGGCTCGTCgggcttgctgctgcaatctTCGTCTCGTGGATAGAAGCTTCAGAGGCTTGCTCGGCGCGTAGAGCTCGATCTCGCAACATGGCTGCGCCGG
ACGGTCCCAGTGTCATTCGTGGTGGGTCGCCTGCGCTGACCGTGTCCACTTCTTCGGTTGCTGATTCGTAATGCGATGACGTTCCTGTCTGATCATCCGG
AGTCAGCGTCGGGTGTGATGTCGCGATTCCCAGTGCTGGTTTCGATCTCGCGATCTTATTGGGTGGCTGGCTAAGCCTACCAAccatctgcttcagcgtc
gtgAAGAGCGTTTGGAGCGCATGCTTAATCACGCATAGCTTAAGATCAAAGAGATCCTCGGCTTCAAAAGCACCGACGACGATCCCCGATTCTTCCAGAA
GTTGGAGCAGCGCCTTCACTGCTTCCAGTTTGTTTGATCCGGCGGCCAGTTCCGACGCGGGGCCCTTGAGATCACCGAGGAACTTCGGACGAAGGATCAT
CATCACGGGGTTCTGCATCAGGAAATCGTTAAGGTCCTTCCTGTAGTACGCGTCTTCCAGCGATTTATCGGTCCAGACTGGCGCAGGATCATCGCGATCT
TCGATATCGGAGTCCGgggccttcatcttcttctgcgaggACTTCGATCTCGCCGATTACTTTTTTGCTCTCGATCTTGGGCCAGGAGGTTGGGTGGATG
AAGCACCTTCAGCTTTCGCTGGTGGTCCTTCATCCGACGGGTCTCGATTCGCGTCGAGGCCCGCGGGGTCCCCGAAGGGACCTGGGGAGGAGGTTGAGGT
TTATCTTCGTAGTTCGTCGCCGGACCTTCCTCTGTTCCGTCGGTAGAGCTCTTCCCAAAACTCTGCTGATCCGCGGATCAACCTTGATTTAGCGGCGTCG
TCAGTGATCCGATCTCCGTCGATGCTTGCTTCCCTGGTCCATTCCCAGCTTGCGCTTCCTCTTCAGGGGACTCACGGTGAAATCCCGAGTCACCCAAAGA
TCCGGGCACACGCAccattgtggtgtagtgggtctgcgcAATTTTAAGATCGCAGGTCCCgctcacacacggcgcccgaactgccgactaacggaggtgg
tactccgatatccgtggGATTGTTgaaccttgctcaccttgtgtN