Description :
From Genome Similarity Track
Location :
Scaffold_950:7701- 11641
Transcript NameFunction/comments
g14302.t1hypothetical protein
g14303.t1hypothetical protein
g14304.t1ABG66535.1 reverse transcriptase, partial [Phytophthora ramorum

Sequence
3940 bases(100 bases per row)
CACCTCCTACCTTAGTGCAACATGCACTAAGGCATACATTCAGGTGACCACCACAGGGTGGTCCACATTCATAGCAAAAGGCATATGACTGGTAGAAAGT
AACACCTTTCTACCAATGAGAGTCATTCAATAGATAGGGGTTCTGCCATCCATCCAATGGTAGAACCTCTCATTAGAAATATCAGTTTTAGGAGGAAACC
CCATTTACAATCAATACAGTTCTCATTTACCACCAAAGCTTTCGTTTGGTTCATTTATCTAGGTTTCAGTATACTTGCGGATACAAGTATACTAAACTTA
AGTAAATTACTCCTACGCTTCCTCCTACACGTGCGCACACGTGTAAGCTTAAGTAGTGGGTCTAAGCAGACCCATTACACCTGGTAGCACTTTTTAGTCC
GTCCAACGACCGACTAACACGTTCGTATGGAATACGAACGCGGGGCTGAGAACCTGCCCTCGGACAGTAACATGTCCGTGGGTAGCCCAAACACGTCTGC
AACACATGTTGCGCGTGCAGACTGCCCCCACCTGTCGGAACCAGAGTGGGAGGCCTCCAACGACTGTCAACAGTCATTGGGGGAGCGGCGGTAGCAACGA
TATTGCGAACGCTATCACCGACGGAGCAACACGGTGTTGCTCTGGGTTTCATCGTGAAGGAACAGCGTGAAACCGCTGCTCGAACTTCGGTGTCGCCATC
GACCACACCGCGCGTGGAGTCATTGAAACTCCACGTAAGCAGCTACGTTGGAAGAGAGGGGGAGCCTCTCCTCCGTTGGCTTGTCGAGGTCGACACTGCC
ATTACGGCTCGACGTATCGTCGACCAGTTGTCGAAGGTTGCGTTCGCCATGTCATGTCTTGGCGGACGAGCAAGGAGTTGGGCGTACGGACGCCGACTCA
CAGATCCTACGTGCTTTAGCACGTACGAAGAGTTCAAGGAGGAGCTCAAACTAGCGTTTGAGCCCCCGCAGAACGAGTTCCGATCGAGGGCGGAGTTCCT
CGATCTGCAACAGGGCAAGCATGACGTGCATGCTTACGCCCAAAGAGCACGGTACTTGGTCTCGAACATCGTGACCAACCCGATTGACGAGGCGACAAAG
GTCGTCACGTTCATGAAAGGCCTTAGAGATTGGCCTGTGAAGACCTATCTCTTCCGAGAGTATCCAAATACTCTCGAGGCTGCAATTGCGCTTGCAATGC
AAGAAGAGTTTAGCCTGCGGCAGGCTAAACTGCATGTGAACGCCCCACGGCTAATGCCACGACCGGTGGCAAGGCCGTCGGGAGGTCCCGAACCAATGGA
CCTCTCGAGTGCGACCGCTGCTGGTTCCCAGCAGCGTCGTGGATCAACGAATGTGCGTTGTTTCCGCTGCGGAAACATCGGTCACTATGCTCGCGGGTGC
ACAGCACCAGTGCACGCGGCGAAGAGCCGTCGTGGCGATACTGAGTATCGTCACGGGCTAACAAAAAATTAGAGGGACCAGCAGGCGCGGGGCGCCCTGC
TGGTGATGCGATCGAGCGTGTCGACATCGGACACGCTGCAATGAAGATCGCTGCCCCCAGTGAGAGTCAATCTCACTGCAAGAAGCAAGATGACAAGCCG
AACCTTGTCATCCTGAAGGTAAGCTCGAAGAGAGAGAAGTCTCTTCGTGCTCTAGTGGACTGTGGAGCGTCGAACAACTTTGTTCGACTGCAGAGCCTTC
CAAGGCTTGACTTCAAGGAGGTGGAAACACCTCGAAGTCTATTGGAAGTGAGGCTAGCAACGGCTGTCGTTGTTAGAACCGAGAAGCGTATCGTACGCGT
ACGCTTCTCTTATCAAGAGAAGGAGTTCGTCGACGAGCTTATCGTCCTGGAACTGGACGATATGGTGTTGGGCATGCCGTGGCTTGCACGGCATGATCCG
GTGATCGACTGGACGAAGCGCACGATCGTGCGCTTCGGGAGCAGCAGCAGCGCGACAGAGAGCGATGGCCCTGTCGGCGCAGCACATGCACCACGTGGTG
CATGCGGCCCTCCATCAGAGACAGCGCGGAATGCGGCTGTCTCCGGTCACCCCAAGCGAACGCCAACGACTGCGAGAGTCGTTGGGAGAAGATGTGAACC
GAATCAGCAGGGCCTGGTTCAATTCGATTCGAGAGGGTCTCGAAGCGTCCGGGGCGACGCGGTAATGTCGACAGGTAATGTCGACACACAATTGGTCGAA
AGACACTCCGCCGTTAGGCGTAGAGGTAAAGAAGACGCGTCGGCTCTGGGAGCCGACGCTGCAAGCAGTGCGGACGGTTGCAATCGTCCCGCACCGGAAA
TGCTTGCGAGCTCGCGTGCAGCCGGGCTGCACGACGAAGCGGTGCGCGATCAAGCCGGGCTTGAACGCGTGCGCCCGCGGGTAAAACCCGCCGGCGAATA
CAAGGAACAACTGTCCACGGCCGGGCCTGGACAAGAAGAAACTCGCGGAGCCGGGCTCCGCACGAGAAGTGAACGGCGCAAGCGAGAAAGCTGCGCAAGT
CTCGGTCAGGGACCGAGACGCTACAAGCAGTGTATGCCGGGTAGACACAGGAGTTGGAGACAACCGTCGAGACATTGAGTGTCTTGACGCGTACGAGTAT
TGGTCCCCAATACAAGAAGATGAGGCTGGATAATCCTCCGACGTTAGCGTCGGAGTTGATGTCGCTCCCAGTCACAAACTGGAAGCGTTTCGCTCGCGAC
CTGCACGATGGACGCATCGAGCAGATCTGCATCCTCTCGGACGTCGAGAGGGTGACGTGTGAAGCAGAAGAGCTGAATCAGCTCATCTCTGAGGGCGCGG
ACGCCCTCAGCGCAAAGTCGAAGAAGGAACGCTTCGACGAGCAAGGCTGGGACTCGCTCAAGGCGAGCCCCTTTTACAAGGTCTTGCGTGAGTACAAGGA
TGTACTCCCGGACGACATTCCTGCGGAGTTACCGCAGGACAAGGGTTGTCAGCACGAGATTGATCTCGTGCCGGGAACGAAGTATTGCGTCACGCGGCAG
TGGCCACTGCCGCGTGAGCAAGTCAAGGCAATCGACGACTTCTTTGAAAGTCGTCGCAATGCAGGACAAGTGCGGGAATCTAAGTCCCCGCACAGCGCAC
CTACGTTCTGTGTGAAGAAACCACAGGGCGGGTGGCGCATTCGTTTCATGCGTACAACAAGTCTGAACGATGCTGTACGTGCCGGCGCAAACGCCGATAC
CTCGAAAGTTGTGATCATCTGATCATGACCCTCGCAGTATAATTCTTCAGTATGCTGATCTGAGAGGACGGGTTCTATCAGATCCTATTCGCGTGAGAGT
GATATCCCTCTCACAGCGGTAAGCACTCCGAGCGGCATGCTCTGGGAGTGGCTCGTAATGCCACAGGGGCTAAAGAACGCCCCAGCGACGTTCAACAGGT
GCGTCACGCACTTGTTGCGCTCGGTGCGCGACTTCGCACCGAGCTATTTCGACGACGTGTTCATTCACAGCCGGGTTGTGAATGGGAAATCGGATGTGGA
GATGCATACAGAGCATCTCCGCAAGTTGCTTGAGCTCATGCGAAAGTACAAGCTCTACGCGAACCTGAAGAAGTGTATCTTCGGGGCGACCGAGATACCG
TACTTGGGTGTCTCGTGGGGAAGAACGGCGTACGCCCTGACCCAGGAAAGGTCAGAGTGATCAATGAATGGCCTACGCCTTCAAATGTAAAGGAACTGCG
GCAGTTCCTTGGACTCGCCACGTACTTGTGCAAGTACGTGAGCAAGTACGCGGGCAGGATTCGCCCGCTGTCGCAGCTCTTAAAGAAAGAGGCTGCATGG
GAATGGACTGCTGATTGTCAGCAGGCCTTCGAAGCAGTCAAGCAGGGCTTGACTGAGGCGCCGATCCTGGCGGTGGCCGACCAAGATCCCCATTCCACGT
GGTGTGCGATGCATCCGATTTCGCGATCGGATGCGCACTG