Description :
From Genome Similarity Track
Location :
Scaffold_23:7700- 9672
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_23-snap-gene-0.35Thioredoxin

Sequence
1972 bases(100 bases per row)
CTGGCGGCGACGTCGGCCGAGTGAGGAGCTGGAAATCAACCCACCACGGGAGACAAGTGCAGGAATGCCCACTCACTGAACGACTGGCTCGACAGCATGT
CCAACACATCTCCACGTGGCGTCTTCGTGACTCTCTTCGGCGATACGTTGCTCTCGCGGAGAGGACCTCTTGACACTGAAGTGGCGCTGAGCGGCAAGCG
CGTGATCGGGATATACTTTATGGCCACTGTTtGTGAAAAGTGCCGTGTATTCACGCCTGCACTGGCTACGGTGTATCGGAATATGCAGCTGAAACAGTAC
CAGCACCTCTCAATGCAGCACGATCTCGAGATCGTCATGGTTTCCACAGACGCGAATGAGGTCGCATGTCGCGATTATCTTCTGCAAACTCCGTTTCTCT
CGGTGCCTGTTGGCCGCCGAGATGTTGCACATAACTTGATCAAATGGTATAGTATCCAGCGAATGCCCAGCGTGGTGTTTATTGACAAGGATGCGCAAGT
CATCGAGAGCAATGGCAGAGCACTAGTGCACGACAAATTCCTTGATCCCGAGACAATATGGAGGGCACTGAATATTCCAGAGATCGCAACATGAGGTTAC
AGCTAGCCTCCTGCcACGAGCCGCACAAGATGTTCGTACAACATCAGCAGATCGAGCGCACTACCAGCGACAGGATGCTTGCTGCCTCTCAGTTCAACCC
CCGAAGCTATGAGTCAACTGTTAAGATTCTCTTTCACCGGAGCATATATTATCAGATCCAACATATAGCTTATAGTTCGACTGGATTGTAGTATTGTGCA
GGGATCAGCTCCCAACCAAGGGCGGTCGCTGCGTGATCACGCTGCTTTAGTTGCGCAGCTTACGCTTGCACCCGGTCTTGCCGGTGTTGTTCGaGTTTGC
TTCGCCGCCGACAGTGCCCTTGTCATTGTTGTTGCTCGGTGTCGCTGAAGCTGGGTTCTTGTTATTGTCATTCTGGTTATTGTTGCTTCCACCGTTGCTG
TTGTTGCTGTTGTTACCTCCAATGTTGTTGCCTGGGgCCTTGCTGCTAGAGGCTGGAGCAGGTGCCTTGCTGCCACCGTTGTTGTTGTTGCTAACCGGCG
GTGTGTTCACGTTGTTCGAAGGAGCCGAGCCACCCTCGCCGATCTTGGCGCAGTTGATGTAGACCTGCCACTGGAGAAGCGTACCCATCCAGTACATCGT
CAGGCGCTTCTTGCCGACGCACTTTGCCTTGTCGTACTTAAaCTTGCCGTCAGGGAaCGTTGCGGCACAGTTGTACGACTTCATCGTCGCATCACACCTC
GCACGGACCGTCGTGGTTCATCTTGCCGCCGTACcACTCAAGCTGGTCAGGGAGGGGTTGGACCGGGCCTGAGGTTGGGTCCGTGAGGCCGCACTCTAGC
GTACGTGGCATGTTGGTGTAGCCCTCGTTGaaggTCTGGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNcgaggaccgcgagtctgagaccagagtgcgtcgtggcaaaGGaGACCATCGTGCGAGTCTCGAAGAAGATGCAGAAAGCAGATGAG
AGCATAAGACCACAATGAGATCAGCGGTCAGCATCGTGCCCAGGGCGAGTGGCCCTCCTTGTTGTCTTCCATGATTGCACTGTACATTGTCGAGGGAgAC
GGATGGAGATTCCGCATCACCAGCTGGCAAGTAGTGATCAACACAGATCTACACTGTCGCCTTAGTCAAATT