Description :
From Genome Similarity Track
Location :
Scaffold_111:77- 6014
Transcript NameFunction/comments
g7397.t1hypothetical protein
g7398.t1hypothetical protein
g7399.t1ETI30235.1 hypothetical protein F443_22644, partial [Phytophthora parasitica P1569

Sequence
5937 bases(100 bases per row)
GCTCAGCTCGCGGAGGTTGCGCAGACGACCTCGAACGTAAAGGTCGAGGTCGGGACGAGGGTCGCTGCCGCCTTGAAGCGCGTCGCCGCGCTCGAGAGCG
CTTTGGCGAGTCACCAGACGTAGGTGACTGGTGCTGCACGTACGGCTTCAGTCGCCCAACGTAAAACGTTGGGTGCAAGCGCATGCTGGACGGTATGTCA
AGTGTGTACGCGTTGCCATGCTTCGCTAACACGGTAAATTGCCCAATGAAGCGCGGAGCAAGCAAGCTTGCTCCGAAATCGGAAACTGCATGTTTAGCTA
GGTTCTGTGTAGCTAACAGAACTAATGAACCAACTTTGAATTCATTTGTGTTTCCCCTGCCGGTGTTATCGGCATTCATCTTCTGTCGATCGACAGAAGC
TGCTATTGCATCTTGGACAAACCGAATTACGGCTTGTCGACGCTGGACAAAGTCCATTGCATCCGAACTGAACCCCTGGTTCAGTTCGTGCTCCTTGTTC
GCAGCAGGCCCGGCCTGCGCGTGATGTTCGTTGTCGTTTAAAGTGTCTACGCCCGTCGTAGACACTCTCTTGTCGTCGCCATGACTGCGCGCAGTACGTG
CGCGAGTCGTCACAGCTGATACATTGCTCGTATCAGTGTGCTTATCCGGTTGTTTTGAATCAACCGGATATCCTCCCCCACTTAAGGAAGGAGCTACCGC
ACCGAGTACGCTCGGTACGCGTGGGTGCCTCATGGCATTCACGTAGAACGGTGTGTGTCCTGTCGAGACATGCACCGAGTTGTTGATGGCGAACTCCGCC
ATCGGCAATCAGTCGCTCCATTGATGGAACGAGTGCGCGTAGCTCTTCATGGTGTCAACCAGCACGCGGTTGACACGCTCTGTTTGTCCGTCGGTCTGCG
GGTGATCCGCAGTCGACATGGACAACTGCGTCCAAAGAAGTGTAAACACTTCTTGCCAGAATCGCGCTGTAAAGCGCGGATCCCGATCCGACACAATGTC
GAGTGGCATACCATGGTGTCTAAACACCATGTCGACAAACAGACATGCCGTCTGTTTGGCTGTCACTTCGGCTGGTACTGCAGCAAGATGCACCATCTTG
CTGAAGCGGTCAACAAAGACCACAATACCAGTCCTCCGCTTGTTGTCTTGCGGAAGACCAAAAACAAATTCCATTGAAATGGACTGCCAGCACTCCGACG
GAGTCGGTAGTGATTGAAGCGGAGGGCGCAGGCTTCACACGCTGGCATACCTCGCAAGCACGAACGTACTTGCGTACCCATTTGTACTGGTGACTCCAGT
AGAAGTCACGCGTGAGAAGCAAGTATGTCTTCTAACGGCCAGGATGTCCCGATGTCGGGGCATCGTGGTACTCGTACGTGATCTTGAGCTTCAGCTCATG
ATCATCCGGCACGACAATGCGTTCTGCGTTGTCGTCGACTGCGCTGTAAAGCAGCAGACCATTGTGTACACGGGCACGAAGGTGTTTGGCCACCTTCTGA
CGAGACTTGTCAGAAGGTGTGGAGAAGTACTCCAACAACTGCTTCGCATCCGCGTCATGTGCGTATGCGGCCTTCACGTCATCTAACAAGGACGACGAGG
GTGTAGTCGTCCTGACGACGCCAACTGCGTTGGCGTCGGCCTCTTGTACCGCATAATCTGGTCGCCGCGAAAGCGCGTCGGCCACGACATTCAACCTTCC
AGGCTTGTACTCAACCTGGAAGTTGTATTCAGCAAAGAATGACAGCCACCGTGCCATTTTCTTTGTGATATGTGCGGCGACTTGATCGCCGTACGCAACG
ATGCGTGGTCGGTGTAGACCACGAATGGTCTACTCCCAAGTAGATACACTCGAACCTTTGCGAGTGCATACTTCATGGCAAGGAGTTCCTTGTCATGTAC
CGGGTAATTGCGCTCAGCTGGCTTCAGCTGACGCGATTGGTAGTAAACCACATGATCACGACCTTCGTGATCGAGTTGCATCAGTGCGCATCCGATCGCG
AAATCGGATGCATCACACACAACGTGGAATGGGCGATCTTGGTCGGCTATCGCCAAGATCGGCGCCTCAGTCAAGCCCTGCTTGCCTGCTTCAAAGGCCT
GCTGACAATCAGCAGTCCATTCCCATGCAGCCTCTTTCTTTAAGAGCTGCGACAGCGGGCGAATGTTGCCCGCGTAGTTGCTCACGTACTTGCACAAGTA
CGTGGCGAGTCCAAGGAACTGCCGCAGTTCCTTTACATTTGAAGGCGTTGGCCATTCATTGATCACTCTGACCTTTCCTGGGTCAGGGCGTACGCCGTTC
TTCCCCACGAGACACCCAAGTACGGGTATCTCGGTCGCCCCGAAGATACATTTCTTCAGGTTCGCATAGAGCTTGTGCTTTCGCATGAGCTCAAGCAACT
TGCGGAGATGCTCTGTATGCATCGCCACATCCGATTTCCCATTCACAGCCCGGCTGTGAATGAACACGTCGTCGAAATAGCTCGGTGCGAAGTCGCGCAC
CGAGCGCAACAAGTGCGTGACGCACCTGTTGAACGTCGCTGGGGCGTTCTTTAGCCCCTGCGGCATTACGAGCCACTCCCAGAGCATGCCGCTCGGAGTG
CTTACCGCCGTGAGAGGGATATCACTCTCACGCATGAGGATCTGAGAGAACCCGTCTGATAGAACCCGTCTCTCAGATCCAGAGTACTGAAGATAGTACT
CGAGGTCATCGAATCGATGATCACATCTTTTCGAGGCATCGGCGTCTGTGCCGGTACCGTCGCATCGTTCAGCTTGTTGTACGCATGAACGATGCGCCAC
CCGCCCTGTGGTTTCTTCACACAGAACGTAGGCGCGCTGTGCGGGGACTTCGATTCCCGCACTTGTTCTGCATTGCGACGACTTTCAAAGAAGTCGTCGA
TTGCCTTGACTTGCTCACGCGGCAGTGGCCACTGTCGCGTGACGCAGTATTTCGTTCCCGGCACGAGATCAATCTCGTGCTGAACACCCTTATCCTGCGG
TAACTCCGCAGGAATGTCGTCCGGGAGTACATCCTTGTACTCACGCAAGACCTTGCAAAAGGGCCCGCCTTGAGCGAGTCCCAGCCTTGCTCGTCGAAGC
GTTCCTTCTTCGACTTTGCGCTGAGGGCGTCCGCGCCCTCAGAGATGAGCTGATTCAGCTCTTCTGCTTCACACGTCATCCTCTCGACGTCCGAGAGGAT
GCAGATCTGCTCGATGCGTCCATCGTGCAGTTCGTGAGCGAAACGCTTCCAGCTTGTGACTGGGAGCGACATCAACTCCGACGCTAACGTCGGAGGATTA
TTCAGCCTCATCTTCTTGTATTGAAGACCAATACTCGTACGCGTCAAGACATTCAATGTCTCGACGGTCGTCTCCAACTCCTGTGTCTGCCCGGCAGACA
CTGCTTGTAGCGTCTCGGTCCCTGACCGAGACTTGCGCAGCTTTTCTCGCTTGCGCCGTTCACTTCTCGTGCGGAGCCCGGCTCCGCGAGTTTCTTCTTG
TCCAGGCCCGGCCGTGGACAGTTGTTCCTTGTATTCGCCGGCGGGTTTTACCCGCGGGCGCACGCGTTCAAGCCCGGCTTGATCGCGCACCGCTTCGTCG
TGCAGCCCGGCTGCACGCGAGCTCGCAAGCATTTCCGGTGCGGGACGTTTGCAACCGTCCGCACTGCTTGCAGCGTCGGCTCCCAGAGCCGACGCGTCTT
CTTTACCTCTACGCCTAACGGCGGAGTGTCTTTCGACAAATTGTGTGTCGGCATTATCTGTCGACACGACCGCGTCGCCCCGGACGCTTCGAGTCCCTCT
CGAATCCGATTGAATCAGGCCCTGCTGATTCGTTTCACATCTTCTTCCAACGACTCTCGCAGTCGTTGGCGTTCGCTTCGGGTGACCGGAGACAGCCGCA
TTCCGCGCTGTCTCTGATGGAGGGCCGCATGCACCACGTGGTGCATGTGCTGGCCGACAGGGCCATCGCTCTCTGTCGCGCTGCTGCTGCTCCCGAAGCG
CACGATCGTGCGCTTCATCCAGTCGATCACCGGATCATGCCGTGCAAGCCACGGCATGCCCAACACCATATCGAACTTATCGTCCAGTTCCAGAACGATA
AGCTCGTCGACGAACTCCTTCTCTTGATACGAGAAGCGTACGCGTACGATACGCTTCTCGGTTCTAACAACGACACCCGTTGCTAGTCTCACTTCCAATA
GACTTCGAGGTGTTTTCACCTCCTCGAAGTCAAGCCTTGGAAGGCTCTGCAGTCGAACAAAGTTGTTCGACGCACCACAGTCCACTAGAGCACGAAGAGA
CTTCTCTCTCTTCGAGCTTACCTTCAGGATGACAAGGTTCGGCTTGTCATCTTGCTTCTTGCAGTGAGATTGACTCTCACTGGAGGGCAGCGATCTTCAT
TGCAGCGTGTCCGATGTCGACACGCTCGACCGCATCACCAGCAGGGCGCCCCGCGCCTGCTGGTCCTTTAGTTTTTTGATTGCCCGTGACGATACCCAGT
ATCGCCACGACGGCTCCTCGCCGCGTGCACAGGTGCTGTGCACTCGCGGGCATAGTGACCGATGTTTCCGCAGCGGAAACAACGCACATTCGTTGATCCA
CGACGCTGCTGGGAACCAGCAGCGTCGCACTCGAGAGGTCCATTGGTTCGGGACCTCCCGACGGCCTTACCACCGGTCGTGGCATCGGCCGCGGGGCGTT
CACATGCAGTTTAGCCTGCCGCAGGCTAAACTCTTCTTGCATTGCGAGCGCAATTGCAGCCTCGAGAGTATTTGGATACTCTCGGAAGAGATAGGTCTTC
ACAGGCCCATCTCTAAGGCCCTTCATGAACGTGACGACCTTTGTCGCCTCGTCAATCGGGTTGGTCACGATGTTCGAGACCAAGTACTGTGCTCTTTGGG
CGTAAGCATGCACGTCATGCTTGCCCTGTTGCAGATCGAGGAACTCCGCCCTCGATCGGAACTCGTTCTGCGGGGGCTCAAACGCTAGTTTGAGCTCCTC
CTTGAACTCTTCGTACGTGCTAAAGCACGTAGGGTCTGTGAGTCGGCGTCCGTACGCCCAACTCCTAGCTCGTCCGCCAAGACATGACATGGCGAACGCA
ACCTTCGACAACGGGTCGACAATACGTCGAGCCGCAATGGCAGTGTCGACCTCGACAAGCCAACGGAGGAGAGGTTCGCCCTCTCCTCCAACGTAGCTGC
TTACGTGGAGTTTCAGTGACTCCACGCGCGGTGTGGCCGATGGCGACACCGAAGTTCGAGCAGCGGTTTCACGTTGTTCCTTCACGATGAAACCCAGAGC
AACACCGTGTTGCTCCGTCGGTGATAGCGTTCGCAACATCGTTGCTACCGCCGCTTCCCCAATGACTGTTGACAGTCGTTGGAGGGCCTCCCACTCTGGT
TCCGACAGGTGGGGCAGTCTGCACGCGCAACATGCGTTGCAGACGTGTTTGGGCTACCCACGGACATGTTACTGTCCGAGGGCAGGTTCTCAGCCCCGCG
TTCGTATTCCATACGAACGTGTTAGTCGGTCGTTGGACGGACTACAAAGTGCTACCAGGTGTAATGGGTCTGCTTAGACCCACTACTTAAGCTTACACGT
GTGCGCACGTGTATGAGGAAGCGTAGGTGTATTTACTTAAGTTCAGTATACTTGTATCCGCAAGTATACTGAAACCTAGATAAAGGAACCGAACGATAGC
TTTGGTGCCAAATGAGAACTGTATTGATTGTAAATGGGGTTTCCTCCTAAAACTGATATTTCTAATGAGAGGTTCTGCCATTGGATGGATGGCAGAACCC
CTATCTATTGAATGACTCTCATTGGTAGAAAGGTGTTACTTTCTACCAGTCATATGCCTTTTGCTATGAATGTGGACCACCCTGTGGTGGTCACCTGAAT
GTATCCCTTAGTGCATGTTGCACTAAGGTAGGAGGTG