Description :
From Genome Similarity Track
Location :
Scaffold_26:77- 4454
Transcript NameFunction/comments
Phyag_g713hypothetical protein
Phyag_g714hypothetical protein PHYSODRAFT_507170
Phyag_g715hypothetical protein PHYSODRAFT_508093

Sequence
4377 bases(100 bases per row)
ttcggacggaggccgtgatgctattcgggtagccacggacatctagaggcaactacgttaggagaatGAAACTCTTCAACGATTAAATGTGGAGTCACTC
AGCACGCCTCAAAGGCACTacgctgcgtcttcatcgaccGGTGACCAATCACTATGCTggtgtcttcatcgtctcaAGTCCCGGTGACAACGAGTCTGCT
GATGCCTTCACCACGGTGCTGGTGACCAAAGTCTGCTGCCCACGCCCAATCCCAATTCAACCCGAACTACTTCGTCAAAACCACGTCGACGTACTTGGCA
ACCTTGTCACCAATGCGTCCTAGGGACGTCGCCTCCTCACCGCTCTTCACCGCCACATCAGCAtcacgaactcgacgagcagcacgcaggAACGCCGTTC
CTCGACCGGTATGGCGATTTTGaagttcttcttcaccgtACTTCACCAAAGAATCCACCAGAACTTGGTTGTCCTCGACTTCAGACGCCTTGCTGCGAAT
ATCTTGCACAATGGGTGGCACAACAGAGTCATGTTCACGCTCCCCATACTCACccccctcttcttcttctccgtctttGGGGTCATACTCGTAGTCTTCG
TCACTATCAGCATGTCCCTGCTGAATGATCTGGTCGATCTTGGCCGCAATGCGTTGCCCCACCATATCGATCTCCTTGCTGGCTTGTCGTCCCGACTTGA
CAATGGTCTTCGAGTCACGAATTTGTTTGGCTGCGCGCAGGTGCGAGATCCCTTTGCCACGGTGACCCGAATACAAGTGACTATCACCGTAGTCTACCAA
CGCATCGACAATCGGCTGGTTCTCCGAGCAGATTGCAGGTTGCTCGCGCAAGTTTTGCACGATCGGAGCAACCGTGTacccaccaccacttccacgcgGG
TAGCGTTTCGATCCCGTGGTTCCGCTGGTGTCCTTCACAATGCGTCCGTGCTTCAAGATCTGGTCAATCTTGTCGGCGATCACGTCGCCGACCAACGGCA
CACTGATTCGCGCTGTCGACCCATTCTCGATCACTTCTTCATGGAGTTGAATCtcacgtgcagcacggagGTGACTCGTTCCTTTGCCAGAACTACTGAA
GTAGAGTTCGTGCTCGCCGAACTTGGCCAATTCGTCTACCAGCACTTGGTTCTCGGCGCATCTGGCTGGAGAATTGTGAATATCGAGCACCAATTGAGGT
CGCATGTGCTGTTCCACGTCGGTGCTCACGTTTTGATCAGCGGTGGCGTCTTTCAGCTTCCCCGTCGCCAGCACTTCCTCAATCTGGGCGGCAATCTTGT
TGCCCACCATAGgaacagcacgagcttcCTTAACCGAGGTAATGACATACGGGTATTTGAGGATCTCCAGTGCAGCACGTAAATGCGAGACTCCCTTGCC
CGTGTGTCCGTGATCGAGCTGCTCTTCGCCGTAATTCGTAAACGCGTCCACAATCTTTTGGTTTTCGGGTTTGGTAGCTTTCTTCGCGCGAGCTTCCTCA
ATCAAGCGGATGGTCTTGTGCGGAGCCATCGAtcctccttcgtcgccgGACTCCTCCACCATCGGTTTATCTTGCTCACCACCACGCTTGcttttcttgt
tgctctggTTCAATTCGGACGAGTGCGATCGCTTAATACGACCGAACTTGTCCATCACCCTCTTCAAAGCAGACTGCAAAGCAAACGGAGTAGTGAGGAG
ATGAACTTGCTCAGTGGTGCCACAAAATAACATGTGTGTTACCTGCTCGTTTCCGTTTGACGCAAGAAGCGCCGTCGCGATTTCGGTTGTCGCCATGTAC
GGGTTCTTGCCAAGAGTTCGTTCGTGTCAGCTAGCAACCCCACAGAAGTATTGAATGGTGGAGTGGTTCATGGTCTATCTAACCTCAGGGATGTCGACAT
GCTTGCTCAAGGCCAACGCGCGCACTTTTCCGACTTGCACGTACACCGCGTTGGATGTTTTCGCATCACACATGGTAGCTCTCCTTTCTCCTTTCGCGCA
AAAACGAGAATGACACAAAACCATAGTCTTCTTCAAATGAGACGTAGGCACCGAGATCTCACGATTGAGATCAGACTTCTCAAGCGAGACAAGAGGATTT
AGCCGCTCGAATCGCGAGAAATGCTTCTTTGCGACGAGGTGCATCCACCATCGGACCCTTTCTCCCTTGTTCAGCAACGACCAGGAAGCTCTCAGCGACA
CTAACCAACATGCAAGCAAGGTGCGTGGACGACAGCATAGCGCAGTGGACGGGTCTTGGAACGGCATATCTACGAGCCCTCGAAAGCTCGCGCGAGGATC
GTATCGTTCACGACCCATTTGCTGAGCGTCTAACGCAGTACAGTCGCGTCGAGATGGAAAAACTCCTTCACACGGAGCAAAATAACTCGTGGGGAGACAT
GATTGCCATCCGTTCTCGGTATGTGGATGAAGCACTGGAAAACCGTGACGTCGGTATCCACCAAATTGTAATCCTCGGTGCGGGCTTGGATACTCGAGCG
TATCGCTTGGAGTCACTTCGAGGATGTCATGTTCTTGAAATTGAACAAAGTCCTCAAGCTTTCGATCGCAAGCGCGAGGTACTAAAGGAGGATAATGCGC
CACCGATAGCGGAGAAAATCGACTACATCGTCGCCAACCTCGCTGATGATGATTGGGACGACAAGCTACTCGGGCGTGGATTTAACACTAAGTTGGCCAC
GTTCTGGGTCATGGAAGGATTGATCCCGTACTTTGAGCGCTCGGACATGTTGACATTGGTGGATACAGTCGATGCGATATCTGCACCCGGTAGTGAACTC
TGGGCGGACGTGGCTGGCGACGCCACCTTTGGATTTCCAGGCACGGGTACCGTCAAGATGAAACATAGCGAGAACGACCCTCTGCGTGGGGTTCTGAGCT
CAATTCCTTGGTGCCTGAAGATTCAAGCCTCGCTGAAGAACGAAGGAGTCCATTTTGGTCGCAAGTGGACACCATTGACTTCCGTGGGCACTAGCAAGAA
CGTGCCAATCTCGTTCATTTTGGGCAAGAAACCTGTGCCAACTGAAGCGTGGGAGAAGGACGTGTGTCCTGGTTTGGAGTGTTGAGCAGTAGCTTAGGCT
TGATTTGCATAGTTGCTAAGTAATAATGCAGACACGCATTGGCGTTACAGCTCGTTGCTCCACACCCATCGTCTTGGGGAAAAATATGGGAAACGTACAT
CGGCGCAAACCGAAACATGCATGACGCGCTGCATTTTTTTCGGTTTGGTTCTGAAGTGCCCACATTTTTTTTCTCGCTGGAACAAGTAATCCTCACCCCA
AGTGCCATGGAGGTCGATACATCTTCGCCGTTATTCCAAGCGGACGCCCCGGTAGTTGATGATGCTTTTGCCGAATCCATGGGTTTCGTGACAACGTACT
TGCGAGCTATCGAGAGCGCTCGAAATGACCGGATCATTGACGACCCATTCGCTGAACCGCTTACCCGGAAGCAAAATGACAAGATTGAGAAGTTcttgga
ggaggtgacggcTAACATCTATCACTCTTTCCCTGAAAACACCATTGCCTTACGTACGCGTTATCTGGACGAAGCACTTTGCCACCGCGACCCACGGATT
CTTCAAATTGTgattcttggtgctggactcgATGCGCGTGCGTATCGTTTGGAGTCGCTCCGTGGTTGTCATGTTCTGGAAGTCGATCAAAGCGCCGCGG
TTTTCGATCACAAGGCGGATGTaatgaaggagctgcacgcACCTCTGATCGCCTGCAATGTGGACTGCATCGTCTCGAATTTAGCCGAGGCAGGACTCGA
AACGAACTTGATGGGCCACGGGTTCAATCCAACAATGCCAACTTTCTGGGCGATGGAGGGGCTGATCCCGTACATCGAACGTTCGAGAATCATCGAGCTA
CTGAAGACGATCAACTATCTCTCGGCTCCTGGGAGTGAATTCTGGGCGGATATTCCGGGTCAGATCCTCACCAACAGTGATGAATGGGGAAAGCGCGCGA
TGAAGTACGGTGAGGATGATCCATTGCACGGATTGTTTAGCGAAATTCCGTGGACTTTGGAGTTGCAGGCGTCACTGAAGACTGCTGGAGAACATTTCGG
TCGTCGCTGGACTCCAATGTTGTCCCCCAAGAGCAATCAAGCTGttccgttcttcttcgttgttgGCAAGAAGCCGATTCCAGCTGTCGTTGTGACGCAG
AAGATGATTGACTTCGAGGACTAGGTGCGATATTGACTTGTTCTCTTTTGCTGTCCAACACTCTCTTCTTTTCCTCTTGATTTCATTTGGACTGCAGTTG
TGCTTAACCACCAACAAGTTGCACGCTTTCAGCTTACCATTTGCTCCGTATTGGATATCCATAGCGTGAGCAGATAA