Description :
From Genome Similarity Track
Location :
Scaffold_2468:77- 2951
Sequence
2874 bases(100 bases per row)
TGGCGGATCTGGTTGTAGAATTCTTCCATCGGGCACTTGCCGACGTCGTGAATCTCGCCACACCCGCGACACACGTAGAAGCAATGATCCCCGGGATGAC
CTTTCTTGCCACACTTCTCACAGACCAGATGTTTCCAGCATCCAGATTCAGTGTGCTTCCGGGATCCGCACTGCGAACACCTGACTTGTGCTGCCCCGTC
CATGAGATCTCGGGATCTGTACATCCCACGGTCCCCGAGCCCGGTAATCCCCCGCCCTCCGGTCCGAAGTTGTTCTCCTGGTCTCTCCCGCTTTCCATCG
TTTGGAAGCCACTGAGAAAGAATCTCCAAGGTAAATCTTCCGGGTGCGGATTCCCAAACCGCCCCGAATCCTGAATCCGTTCCTGGAGTCGGGCGCCGTG
AATTGGTGGACACGTCGAGCTGGGGCCGTAGGCGTCGAAGCCTTTTGGCGATACTTGCCGGACCCGACCGCCGCCTTCTTCTGGCGGTGTTTCGCGCGAT
CCACCGCCCGCAGTACTTCTTCAAGCTCGTCTGCGTCGGGAAGTCGTAGCAGGGTCAGCCTGTCAGCCAGATCCACATCTCCCAACGTCTCGATGAAATG
ATCCACGTGTTCCCGCAGTACCTTGGATCCCCTATCCTTGATCTTCAACTTGGCCCGTAGACCGGCCACATTTAGTCGATGTAGGTATTCCAACGGGGAT
TCATCCGATCTGCGGCGAGCATGGTAGTATTGTCGTGCCACCGACACTCCTAATCCACAGTACTGGGTCTGGAAACTGCGCAGCAAATCTGGCCACTTGT
TCCTGGTTGATCTGCCCAGCTGCCGATACCAGTTCCTGGCTGGCCCCGCTAGCAGATCCGCAAAGGTCAGACACTTCTCAGCATCCGACGCTTGATCTCT
CATGAGGGCCGACTTGACTTTGCTGATCCATGTTCTCGCTCGGTCCTCATCTTGATCCTTGCCCGTGAACCCCTTCAAGTCCGATATAGCTGAGATCCGT
ACCCTCTGGATCATAGACGATCCACCTGCCCCGGCTGTGGCCGTTGCTACCACGGCTGCCGAAGTGGATGGGCCATCCAGATCGTCTGGGTCGAACTCAT
CATGGGAGTTGTCCCCCTCTACTGACTCCATCTCCACGTCCCGTGCTCCATGTTCATGGAGCACTTGCACTTGTGGCACGGGCGCTCTCATACCCTGTTC
GGCCAGGAAGCGATTCATCGCAGCTTCAAAGTGCCGTTGCAGGGTGCCCGCGGACGTGTCGGAATAGCCTGTGGCCGTCTGGTCCACTGGCGGGACTGGA
TCCGTGAGGCGATTACCTCGAGCCTGATCTGACGATAATCCCACTGGCTTCTTGCCGGATCTGGCTCGATCCTGGCTGGATTGTGTCAAATCACGCGTAG
GGCGTACTGGATCCCGAGCTTTCACGTTCACAGGGGCTTCCTGTCCTCGGATCCTCGCCCGCGCTTCCAGCATGGAATGCCCCGGAGGGTCCTAAAGTCA
TGCGTCGTGGTTCGGACGACGTGTCTGACTCATCCTCAGCGGCAGATTCGTAGTTTGAGGACGCAGCTTGGCTGATCCTCGGCGATGACACTGGATTCCA
TAGTGCGCGACCTTTCTCCGGTGATGGACCTAACTCTGCCAAAAGAGGTCCTGCGTCGCGGATGCTATGAGATCCAAGTCTAGCTCGAAGATATCTTCTG
CGTCGAACACACCAGCTACGATGCCTGACTCCGTAAGCAAACGTAATAGATCCTTGACTGCCACCACTTGTTCGCCGTTTTCGTTGGTGCTCTCACCGGT
TCCCTTGGATCGTCGATCTGTCGTGGATTTAGGATCCGCATGACAGGATCTTGATGTAGAAAGTCGCGTAAAGCTTGGTGGCGATACACAAACTCGAGAT
CCTTGTCGGACCAGCTCGACCTGGATCCAGCTTGGTCTTCTTCCGACTCCGGAGCTTGCATCTTCTTCCGCGTAGTCTTACTCGTTTTCGTCTTCTTTCT
CGTTTCTTCGACTAGCGGGCTTGGGTTTAGGTACGGTGTTGGCTTAACCGGTGAATCTGCAAATGCATACCGTTTCGCCTTCACTTTCCCCTGTTTTGCG
AGCGGATCTTGACTTGCGTCAAGATCCGCAGGGGTCCCCGAGGGGACCTGGGGAGGATAGAGAGGTTTCTCTTCTAGATCCGGATCCGGATCCACCTCTC
TTCCGTCGACAGAGTTCCTCCCAAAACTCCATCGATCCGCGGATCTTGTTTCATTCAGCAGCGTCTTCGTCGATCCGACTTCCGACGACGCCTCTTCCCC
TGGCTCAATCTTCACTTGAGCATCTTCTTGGGACTCACGGTGAAATCCCGAGTCACCAAAAGATCCGGGCACGCGCACCATTGTGGTGTAGCGGGATCAG
CAAAATCTGCGAGATTGCCGGATCCAGCTTACCAACTGCACCCAGACACCGACTAACGGAGGGGGTCCCCCGATGATCCGTGTTCTGCTGAACTTTCCTC
ACCTTGTGTACCCGTCGGTAGGGCGGGATCTTGCTCTCTCGGTAACTTCCGAAAAGTTCAAGTGGTGAAGCTTGAGCGTCTTGGCGAGACGTGGGGATGG
GGTGGAGCAGCAGTGGAAAATCTTCACTCTGCGTCCGTGGATGGTTCCGTATCCTAAGCGAATATTCGAGCTTATGGATCCGGGGCCTAGATCGTGGATC
TAGCCGTAGGGTTGCCTTGCGGGTGTGTTCCCTTGCCTTTGTGTTGTCCTTTGCGTCGTACTTGCCGCCTCCTGTGACGGGATCTTGAAAGTTGAGAGCC
CCTAGGGTGTAACCGACCAAGTAGTAAATTCGGTTAACCTGTCGGATCTGCACAAGTAAAGGAAAAGCTCACTA