Description :
From Genome Similarity Track
Location :
Scaffold_593:77- 20879
Transcript NameFunction/comments
g14383.t1hypothetical protein
g14384.t1hypothetical protein

Sequence
20802 bases(100 bases per row)
GGAGCTGTGCGACGGGTGTGCACTCGGCAAGCAAACGCGAGTGAGCTACATGAAGTCGTCCCCGAACCGTGCGAAGCAAGTGCTGGAGGTGGTTCACAGC
GATGTGTGCGGCCCCATGCAGACGCCAACGTTTGGGGGCAAGCGCTACTTCGTCACGTTCATCGATGACAAGTCGCACTTCTGCGTCGTGTACTTGCTGA
GGAACAAGTCCGAGGTGGCTGCCAAGTTCGCGGAGTTTGTGGCGTTTGCTGACACTCAGACCGGCAAGCGCGTGAAGACACTCCGGAGCGACAACGGTGG
TGAGTACACCTCCGGCGCGATGGCCAAGTTCTGTGCGGACCGTGGTATCGTGCAGAAGTTCACTCCGCCGTACACGCCTCAGCTGAACGGAGTGGCCGAG
CGGATGAACCGGACGTTGGTGGAGTGCGCGCGCTGCATGCTGGAACATGCCGGCTTGCCCAAGACGTATTGGGGTGAAGCGGTGATGACGGCTACGTTCC
TCCGTAATCGGTGTCCGACACGCGCCATCAGCCACGACAAGTCTCCGCACCAAGTTTGGACTGGCAAGAAGCCGCTGCTGGCGAACCTGAAAGTGTTCGG
TTGCCACGCGTATGTGCACGTGCCGAAGGCGAAGCGCACCAAGTTCGACGCTCGGTCGGTGCGCTGTCGGTTCCTGGGGTACTCGGAGCACGAGAAAGCG
TATCGATTCGAAGAACTGGAGAGCAGTCGCGTGCTGGTGAGCCGCGACGCGCAGTTCATGGAAGACGTCTTCGACGGTGGGAGACGCGACTACCATCAGA
GGGAGGTGGTGGTCATTCAAGATGAAGAGACGACGGATCAAGATTCGTCGCAGTCGGATGAAGACGGCAACGAAGAAGAGGAAGAAGAGGAAGCTGCGCG
GGACGAAGACTTCGGGCCCGGCAACAAGCGACACCCGCGGACGCAGTCACTGGAGGAAGTCACGGACGTTCCAAGTGCCAAGCGGTATGCGTCGCAGAGT
CGACACCAGACGCTGGACGAGATGTCTGCTGCGGCTCAAGAAAGTCAAGACTTCGAAGCTGCGTACGTCGTGGATTCAGTGGGAGAAATGCCGACCACGT
TCAAGTCGGCGATGGAATCCAGCGACGCAGTCAAGTGGAAGGAGCGTGCGACTCGGAGTGTGACTCGCTGCTCAAGAACGACACGTGGGATGTCGTACCA
CTGCCGAAGGGACGCAAGGCGATCGGCTGCAGATGGGTGTTTCGCGTGAAGGAGAACCAAGCTGGAGAGATTGAGCGGTTCAAGGCGCGACTGGTGGCCA
AGGGTTTTCGCAGAAGTACGGCATCGACTACGACGAGACCTTCGCACCAGTGGCCAAGTTCACGTCGATCCGGATCGTACTGAGTCTGGCTGCCAAGTAT
GGTCTCAAGCTGCACCAGATGGATGTCAAGACTGCGTTCCTCAACGGTGTGCTGGACGAAGACATCTACATGGCACAGCCGGATGGCTATGTGGACGAAG
ACCACCCGGACCACGTATGCAAGCTCAAGCGGTCGCTGTACGGACTGAAGCAGTCGCCGCGCATGTGGAACCAGACCATCGACGACTTCATGCTCAAGCT
GGGGTTCAAGAAGTGCGAGTCCGACCACTGCATCTACCTCAAGCGTGACGGCCAAGACATGATCATTGTGGCGCTCTACGTCGACGACTTGGTCCTCGCC
AGCAGCAACGACGAGCTGTTGGAATCGACCAAGCACGCGTTGAGCAAGCGGTTTGAGATGACGGACCTCGGCGAGCTGGAGTATTTCCTCGGGATGGAGA
TCAAGAACGCCCGCGACTCCGGAAAAGTGACGGTGCGGCAGACCAAGTTTCTCAAGTCCATCCTGACCAAGTTCGGCATGCAAGACAGCAAGCCTGTGAA
GACGCCGCAAGACGCCGGACTCAAGCTGACCAAGAACATGTGTGAGGGTGGCTGCCAGCATGAAGACACGATGAAGAACGTGCCGTATCGCAGTGCCGTC
GGTGCTCTCATGTACTTGATGATGGCAACGCGTCCGGACCTGGCTGCTGCAGTGGGAGTACTGAGCCAGTTCTCTGCCGACCCGTGTCCGACGCATTGGC
AAGCCCTCAAGCGTGTGCTGCGGTACCTCCAAGCGACGCCTACGCATGGACTCGAGTTCTCACGGGAAGACAGCCTTGGTATGTGCGGATATTCGGATGC
GGACTGGGCCGGCGACATCGAGTCAAGACGGAGCACAAGCGGCTACGCGTTCATGATGAACGGCGGATGCATCAGCTGGAGGAGCAAGAAGCAGCGGACG
GTGGCGCTGTCTTCGACGGAAGCAGAGTACATGGCGCTATCGGAGGCGACACAAGAGGCAGTGTGGCTCAAGGTGTTCCTGTGCGAGCTCGGCGAGATGG
CAAGCGATGAAGCGGTCAAGATCTACGAGGACAACCAAGGCTCCATCGCGTTGGCCAAGAACCCGCAGTTCCACAAGCGCACCAAGCACATCGACATTCG
CTACCACTTCGTGAGCGAGAAGGTGGAAGACGGCCAAGTGGTGCTGCAGTATGTGTCGACAACCGACATGCTGGCGGACATGATGACGAAGGCAATTCCT
GCAACGCAGTTCCATGTGCTCCGGACCAAGCTCGGGATCCAAGGTGCAATCGCTGTCGAGTCGAGTGGGAGTGTTGTCAAGAAGGCGCCTCGGGCAGCTG
CCGTATACCGGTAGGATACCGGTATGACCTTCACTCAGTGGGACCGCAATCATTCCTGTGTTTACGGGACGCTGATGATGGGACGCGGGACACTGATGAT
GGGACGCTGTTTACGCTACGGAGATTACGGGACACGTGGGTACAAGATTGTGGGTACAAGATGGGCATCCACGTGGCAGTCGCTGACTGGCTGAAACAAC
TCAGTATCCGGTAAGGAATCCAGTAGAGTGTATCCAGTAGAGAATCCAGTAGGCTTAGAGGTAGCAAGGGAGTTTGCGAACTAAGGACCTAAATCAATCA
CTTTGCATTTTGCCATCAACCGACCAAAGCCTTTTATGTTGAGGACCTCGTTGCAGTGATGCAACACGTTCCCGCCTTCCGATATCTCCATGCTGAAGAG
TTGGCGCTTCAGGTAGATGCGACCAGCCTTCTGCGAACCACCGTAAAGCGTCTTCAGGCGCGTCCACGCAACCCACGCTTCCTCGCATTCGTCGACCACA
TGGTGGTAGTCCGCGTCCATGTGGAGCAACATCAGTCCGAACGCGATGTTGCTCGACTTGACGTACTCGTCCTTGGGCCGCGAGTCCGTGAAGCTCGGCG
TCGTCTCTCGGTTCACGACATGCCACACCGACTTGGTCAGGAACACGCCACGCATGTAGCGGTTCCACGTCGCGTAGTTGTCTCCGTTGAACTTGTCGAT
GGAGATCTTGGTAGAGGCGTCGTGGGCAGAGGTTGTGGTGTAGGGAAACTCATATTTTGGGTAGACCACCCATTCTGGCTCAGCTAAGTACGTCGTACCT
AATCGGAGTTCGCACCTAAGCGGCGAACTCGGCGAATCGGTCGGACTCGGCGAGCTCCAAGATTCAGCGACTCAGCGAGAGTATTCCATTTGGGAGTTAT
TCCAAGTGGGAGAGGATAAATCAGGAATCGGAGCGAAGGGTCGGCCGAGATCCATAACGACCCGACTCGGCGAAGATCAACTAGGAAGCTGAGCGAAGAG
TCGCAGAGAGATCTATAACGACTCCATTTCACTAGGTATTTGTATAGGATCGATAGGAGACCAAAAGGGGGGGCCCGAAGGGACTCCCCGAAGACACAGA
GATAACAAAACAGAGCAGAATCTTCTAAGTCCAAGAACAGCGTATACTTTCCGGTAAGTCCCTGCGTGGGCTGGATTATGTCTGCCGTCGTTCCCCGAGA
GGCATAGCTTGTAGGGGAATCGACTGGTAGCGCCAAGAGATCAAGGTCGGCCCGGGGTGGGCACTTCTCGCTACCAGCGAAGACAAACCTCGTCGAATCG
ACGAGTCGGTGGGTCTGCACAACCCAGGACACCGCAATCTTCTAGCTGACCGTACTCTGCGCTCTGTGACCTGTAAAAGCGCTCGCGCGCCGACGTCCAT
CCTTTGGTGGAGGTCGCAGGGTTTGAGGAACGGAAGCTGCCCCGCTCAGGCGAGCTTCTGGAGTTTGGATTGGTACTCAGCGAGAGCAGGGCCTCAACTG
GACCCGGCTGGGCCGAACCGCAAAGGGAACCAACAGAACCCTGCGCAAGCCCAACAACGCCGACCTGACTCGGCGAATTGTTGTGTTGTTGCGTGGAAGA
CGCACTAACGAAGTTTTTGTGAATCACAACACCACCCAAGACAGCAAGCCTGTGAAGACGCCGCAAGACCCCGGACTCAAGCTGACCAAGAACATGTGTG
AGGGTGGCTGCCAGCATGAAGACACGATGAAGAACGTGCCGTATCGGAGTGCCGTCGGTGCTCTCATGTACTTGATGGTGGCAACGCGACCGGACCTGGC
TGCTGCAGTGGGAGTGCTGAGCCAGTTCTCTGCCGACCCGTGTCCGACGCATTGGCAAGCCCTCAAGCGTGTGCTGCGGTACCTCCAAGCGACGCCTACG
CATGGACTCGAGTTCTCACGGGAAGACAGCCTTGGTATGTGCGGCTATTCGGATGCGGACTGGGCCGGCGACATCGAGTCTCGACGGAGCACAAGCGGCT
ACGCGTTCATGATTGATGGAAGGTATGGATCTTGGACACCGAAGCTTGACGGAGCGGAGGGAGGGCAGCACTCTGGGCGAGACCGGAGCGGAGACTGGAA
ACCACTTGAGGGGTAGAACGAAGATTCGAAAGTGATTGATTGAGGTCTTTAGCTCGCTAGCCTTCTCGCTACTCTAGACCTACTGGATACACACTACTTG
ATTCTTTACTGGATACTGAGTTACTTCAACCAATGAGAGAGCGCCACGTCGAAGCCCATCTTGTACCTACAATCTCGTACCCACAGGTGGCGTAATCGTC
GGTGGCGTAATCGGCGTGGGTTCGGATTGGACCGGTTCGGGTTAACCGGTTCACGGTCAACAACCGATACCAAACCGGTAACCCTCAATACGCCCCCTTA
ATGCGAAGTCCCATGAATGCCGAGAGCCGCCGTCAGCTCCGTGTGGCGTGGTCCCGCAAGCGCCTTCGTCATGATGTCCGCCAGCATCACAGAAGTCTCG
CAATACCCGAGCTTCACTTCACCGCGTTTCACTTCGTCGCGGATGTGGTGGTACTTGATGTCGATGTGCTTGGCGCGGCCGTGGTTCACCGGGTTCTTGG
TCATCTTGATGCACGACTGGTTGTCTTCGCGGATCATGAGCTCGGGTCCCGTGTCGTTGGCAGCCGCCAGAATCTCGCACAGCAGGCGATGGATCCACTT
GCCCTCTTGGATAGCCAGACTGAGCGCGATGTACTCCGCTTCGCTCGTGGACAGCGACACGTTTGACTGCTTCTTGCTTCCCCAGCTCACAGGCGCACTC
ATCAGCATGAACGTGTAGCCTGAAGTGGACTTGCGGTCCGCGAGGTCGCCGGCCCAGTCCGCGTCCGAGTAGCCACGAAAGTCGATCTTGTCGCCCGGCT
TGAAGCAGATGCCATGCGTCTTGGTGCCTTGCAGGTAGCGAAAGATGCGCTTGACCGCAACCCAGTGTTCCTCTTGGGGGTTCTCCATGAAGCGCGACAC
ATAGCCAACGGCGTACGCGATGTCCGGGCGCGTGGCGGTCATCAGGTGCATCAGCGCACCAACAGCTTCGCGAAACGGAGCGTTCACCTTGGTCGCCGCG
TCGCTTGGAATCAGTCGAGTGCTCATGTCCACCGGACTCACCACAGCCTTGCACTCGTCCATGACGAAGCGTTTCAGGATGTCGTCCACGTAGCGACGCT
GGCACATGGTCACGCTGCCGTCCGGGCCGTCCACCAGCTCGATCCCAAGAACAAACGCGCACTTGCCGCTGTCGGTCATCTCGAAACGCGTCTTCAGGTC
CGTCTTCGTGCGCGAGATCAGCTCAGGCGAACTCCCGGTAATCAGCACGTCGTCCACGTACACCAGCACTAGCACGCACTGACCGTCCACCACCTTGATG
TAGAGGCACGGATCGAAGGCCGACACTTGGAAGCCGATAGAGCACATGAACTCGTCGAAGGTCTCGTTCTACACGCGCGAAGCTTGCTTGAGACCGTAGA
TGGCCTTCACCAATTCCAGGCAGTCGAAGCCACCATCCAGTTCGACGCCTTCGGGAACCACGCAGAACACCACCTCCTTCATGACCCCGTACAAGAACGC
TGTCACGACGTCGAGTTGGTCGAGGGGCCAGCCGAAGTACTTGGCGATCGCGATGATCATGCGCAGCGTCACGTACTTGACCACGGGCTAGAACGTCTCC
GTGTAGTCGATGCCGTACTTCTGGTTGAAGCCCTTGGCCACGAGGCGCGCCTTGTACTTCTCGATCGAGCCGTCCGCTTTGCGCTTGATCTTGAACACCC
ACTTGGTGCCGATGGCGCGCTGGCCGCTGGGCAACTTGGCAGCTCGAAACACACCACGCAGTCGCATCGACTTGAGCTCCGCGCGGATCGCCTTACGCCA
GTGCACTTGATCCGGACCGTTCACAGCCTCTTGGAACGTTGTCGGCTCCGATAGATCGGCTGCTGCTTCCACAGCGTTGGCACTGGCACGCCAAAACACT
GGGGGCGTCGAGTCGTCGTCTTCATCTTGGTCCCCAGACTTTTCTTCTTCGTCGGGTTCAGCTCGGCGCGAGGAGGATACGTCCGGTGCACTTGCTTCTT
CTAAGCCAGCTCGGTGGCGAACGGGGCGCGATCTTCTGGCAGTGTCGTCGTCGCCACTCGGTCGGCTCTTGCGCTTCCCCGCCTGCTTGAAGCTCGTTTG
GCGCGGTCCATCGTTGTCGTCCAGGTTCAGCGCGTCCAGGTCCAGCGCAGCATCATCGACGTCTTCATCCGAAGTATGCGCCGAAAGTCCAAAGGCCGAC
TCATCGAAGTTGACATCGCGACTGACAACCACCTGCCCCGCCTCGATGTCATAAAGTCGATACGCCTTGGACACTTCTTCGTAGCCGAGGAACAGTCCGG
CGCGAGCCTTGGGGTCCCACTTGCGCCGCTTTTCCTTCGGCGTCAGGATGTACGTCTGGCATCCGAACACACGCATGTGCTTGACACTTGGCTTGGACTT
GTACACGATCTCGAATGGAGTCTTGTGCTCCACCTTGGGTGACGGCAGGCGGTTCTTCACGTAGATGGCCGTCATGGCCGCCTCAGCCCAGAAACACTTG
TCCAACTTGGCGTGATACAGCATGCTGCGGCCGATCGTGACGATGGTCCGGATGGCGCGTTCTGCCGTGCCGTTGGTCTGGTGCGCGTACGGAACCGTGG
TTTGCTGCTCGATGCCTTCGACTTCGTAGAAGGCCTTGAGCGAGTTGGTCGCGAACTCACGAGCTCCGTCGTGCCGCACAAACTTGATCTTCTTGCCGAA
CTGCGTCTGCACCTTCGTGACGTACGTCTTGATGCAGTCTTCGCTCTCCGACTTGGCACGCAGGCAGAACCCCTTCATGCATCCGCTAGCTTCGTCCACG
ATCAGCAGCAGATACTTGCTGCCACCCAGAGACTCTTCTTCCATGGGGCCGCAGATGTCGAAGTGGAGCAGCTCGAACGTGTCGTAGCGACGCTTGTCAC
GGTTGCTTGGGAACGACTTCTGGACCATTTTGCCTTGCTGGCAGCCGCGACACACGCTTGGTCCACTCGACTTGGAAGGTGCCTTCGCGTCCTTGATCAT
GTCGTTGTCGACCATCTTGCGAAGCACCTCCACCGGAGCGTGACCCATACGCGCGTGCAGGTCGATCGTCTTCCCACTGGTCGCTGCATTCGCCGATCGC
TGAGGCGTCTGGAGCCAGTAGAGGCCATCCACGAGGTTCGCCGCCGCCACCACTTGCTTGGAGGCCTTGTGCGCAACGCGCATCTGGGTGTCGTCGAACA
CGACTTGGAACAGACCACTCTTGTTGATCTGTGGCACGGAGAGCAGATTCTTGCTCATGCTCGGAACGTACAGCGCGTTCTTGATCTCGATGTCGCGCTC
GTCGCCGTTGGGCAGAACCACTCGTTCCACGATGGTTCCCACACCCATGATGGCCGCCTTGTTGCCGTCGGCCACCGAAAGTTCGCCCTCGTTTCGCTCA
ATCAAATGGGCGAACTTGGCCTTGTCGTTGCAGATGTGGTGCGTTGCGCCGCTGTCGAACGCCCACATGCCGAGCATATCCTTGCCCGTCGAAATGCCAC
ACTCCAGTGAGACCGCGAACGCCACTCGATCATAGCCGTAGCCGTAGTCGTAGTTGCCGTCGTCGTTCCTCCACTGGGCATTGTTGGCCCCGCGTCCACG
GCCATTGCCATTGCCATTGCCATTGCCGCCGCGTCTTGGGCCCCGATTCTCGTCCTTCTGCTTGGTCCAGCACTTGTCGACCGTGTGCCCCAATTTCCCG
CAGTACGTGCACTGGCGAGACTCTCGGTCGGTGTTGAACGCCTTGACCGCGTCCTCCGTCTTCACCGTCGCCGTCTTCTCGCCTTGCCGCTTGATGTGCT
CATTCGTCAGCACCTTCACGACGTCTTGCGATCGCAGCTCAGCGCTGCTCATCTCCAAGTTCAGCACGACGTTCTCGTAGTCTCGTAGCTCTTGGGGAGA
CTGCGCAACAGGCAGATCGCCACGTCCTCGTCCTCCATCTTGGCGCCGATGCTGCTGAGCTTTGAGCTGATGTTGAGGACCTCGTTGCAGTGATGCAACA
CGTTCCCGCCTTCCGACATCTTCATGCTGAAGAGTTGGCGCTTCAGGTAGATGCGACCAGCCATCTGCGAACCACCGTACAGCGTCTTCAGGCGCGTCCA
CGCAACCCACGCTTCCTCGCAGTCGTCGACCACATGGTGGTAGTCCGCGTCCATGTGGAGCAACATCAGTCCAAACGCGATGTTGCTCGACTTGACGTAC
TCGTCCTTGGGCCGCGAGTCCGTGAAGCTCGGCGTCGTCTCTCGGTTCACGACATGCCACACCGACTTGGTCAGGAATACGCCACGCATGTAGCGGTTCC
ACGTCGCGTAGTTGTCTCCGTTGAACTTGTCGATGGAGACCTTGGTGGACGCGTCGTGGGCAGAGGACATGGTGCTTGGGCTCATAACCTGATGGAAGGT
ATGGATCTTGACACCGTGAAGCTTGACGGAGCGGAGGGAGGGCAGCACTCGGGGCGAGACCGGAGCGGAGACTGGAACCACTTGAGGGGTAGAACGAAGA
TTCGAAAGTGATTGATTGAGGTCTTTAGCTCGCTAGCCTTCTCGCTACTCTAGACCTACTGGATACACACTACTTGATTCTTTACTGGATACTGAGTTAC
TTCAGCCAATGAGAGAGCGCCACGTCGAAGCCCATCTTGTACCTACAATCTTGTACCCACAGGTGGCGTAATCGACAGTGGCGTAATCCTTGGTGGCGTA
ATCGGCGTGGGTTCGGATTGGACCGGTTCGGGTTAACCGGTTCACGGCCAACAACCGATACCAAACCGGTAACCCTCAATACATCCATCTGGTGCAGCTT
GAGACCATACTTGGCAGCCAGACTCAGTACGATCCGGATGGACGTGAACTTGGCCACTGGCGCGAAGGTCTCGTCGTAGTCGATGCCGTACTTCTGCGAA
AACCCCTTGGCCACCAGTCGCGCCTTGAACCGCTCAATCTCTCCAGCTTGGTTCTCCTTCACGCGAAACACCCATCTGCAGCCGATCGCCTTGCGTCCCT
TGGGCAGTGGTACGACATCCCACGTGTCGTTCTTGAGCAGCGAGTCACACTCCGAGTCGCACGCCTCCTTCCACTTGACTGCGTCGCTGGATTCCATCGC
CGACTTGAACGTGGTCGGCATTTCTCCCACTGAATCCACGACGTACGCAGCTTCGAAGTCTTGACTTTCTTGAGCCGCAGCAGACATCTCGTCCAGAGTC
TGGTGTCGACTCTGCGACGCATACCTCTTGGCACTTGGAACCTCCGTGACTTCCTCCAGCGACTGCGTCCGCGGGTGTCGCTTGTTGCCGGGCCCGAAGT
CTTCGTCCCGCGCAGCTTCCTCTTCTTCCTCTTCTTCGTTGTCGTCTTCATCCGACTGCGACGAATCTTGATCCGTCGTCTCTTCATCTTGAATGACCAC
CACCTCCCTCTGATGGTAGTCGCGTCTCCCACTGTCGAAGACGTCTTCCATGAACTGCGCGTCGCGGCTCACCAGCACGCGACTGCTCTCCAGTTCTTCG
AATCGATACGCTTTCTCGTGCTCCGAGTACCCCAGGAACCGACAGCGCACCGACCGAGCGTCGAACTTGGTGCGCTTCGCCTTCGGCACGTGCACATACG
CGTGGCAACCGAACACCTTGAGATTGGCCAGCAGCGGCTTCTTGCCCGTCCAAACTTGGTGCGGAGACTTGTCGTGGCTGATGGCGCGTGTCGGACACCG
ATTACGGAGGAACGTAGCCGTCATCACCGCTTCGCCCCAATACGTCTTGGGCAAGCCGGCATGTTCCAGCATGCAGCGTCCACACTCCACCAACGTCCGG
TTCATCCGCTCGGCCACTCCGTTCAGCTGAGGCGTGTACGGCGGAGTGAACTTCTGAACGATACCGCGGTCCGCACAGAACTTGGCCATCGCGCCGGAAG
TGTACTCGCCTCCGTTGTCGCTCCGGAGTGTCTGCACGCGCTTGCCGGTCTGAGTTTCAGCAAACGCCACAAACTCCGCGAACTTGGCAGCCACCTCGGA
CTTGTTCCTCAGCAAATACACCACACAGAAGTGCGACTTGTCGTCGATGAACGTGACGAAGTATCGCTTGCCCCCAAACGTCGGCGTCTGCATGGGGCCG
CACACATCGCTGTGAACCACCTCCAGCACGTGCTTCGCGCGGTTCGGGGACGACTTCATGTAGCTCACTCGCGTTTGCTTGCCGAGTGCACACCCGTCGC
ACAGCTCCCACTGCTTCACCGACGCCATGTCGATGCCAACACCGTAGCTCTTCTTGACGATGGCGTCTAGACCGCCATGGCCAATGTGACCAAGTCGGAG
GTGCCAGAGGTACGACGTGGTGTCCCCTTGGCGATCCTTCGAACTTGCCGCATTGGCCTCGTCAGGCATCATCGGAGTCATGCACAGCTTGAACAGCCCT
TTGCCCTCACGAGCGCCGAGCTGCCACTTGAGACCCTTGTTGTCCGCGAAGCACCCGTCGCTCTCGAAGGTCACTGGCCCGACGTCCTTGGTGAAGCGGC
CGACCGAAAACAGGTTGCGCGACAGCTTCGGGATATGCCACACATTCGTGAGCACACCCTTCTTCATGCCGCGCGGCGTCTTCATCGACATGACAATGTC
GCCGGTCCCCACCGCCTGAACCACACCGTCGTCCGCGAGATGCACGTCCACCGGAGCCATCGTCTTGTAGTTCCTCATGTACGTCTTGGAACTCGTCATG
TGCTGCGTCGCACCCGAGTCGACCAGCCACATGTCACTCGGCTTGGCGGTACTGCTCGTACGACCAACCGAGAAAAGGTAGTCGCCAGGATCTTCTTCGT
CCTGCGCGACGTTCGCACGCTGCGACCGATATCGCTCAGCGTCGTTCTGGGCCCGCGAGGGACACTCCGCGATCCAATGTCCTTGTTTGCCGCAGTTGTG
GCACGCGCCGGTCTTCTTCACCGGTCGGCCCTTGCGCTTGTTGTCTCTCGTCATGAACGCTTGACCTTGGCCGTGCGCGGCTCCGTCGACGCCACCACCA
CCTTGTTCCTTGCGCTTCATGTCCTCATGCAGCAGCCGAGACGTCACGAGTTCCCACGACAGCGAGTCGGCTCTCGACTCCAACGCCGTGATCAGGAACT
GGTACGACTCGCTCAGACTGCCCAGAAGCGTGATCACCAAGTCGTCCTCGCTGACCGGAGCGCCAACCGCGTCGAGCTGCTCCGCCAGCGTCTTGAGCTT
GTTGATGTGCTCCAGCACATCATCACCTTCGTCCATCATCGTCGTGAAGAAACGCCGACGAAGAAAGAGCTTGTTGGCCAAACTCTTCTTCTCGAAGTGT
CCTTCCAGTCTTGACCATGCATCATGCGCGTCCTTGGCCGAGCGAACCAGCGGCAGCTGCGAGTCCTCCATCGCGAGACAGATGATCGCCAGCGCCTTAC
GCGACTTCCTCTTGAACGTCGCTTGATCCGCCGTGGTCGTGCAGTGCTCCAGCTTCACTCCCCCACTCGTCACTTCCCACAGTTCGCGCTCCTCGAGCAC
CATCTGCATCTTGAACTTCCACGTGTGGAAGTTGGTTCCGTTGAACTTGTTGATGCGGGCGGTCGTGGTCGGGGTGGCGTCCATGGCGAAGGCGTAGTCG
GGGTCTTGGGCAGGGAAGACGGGGCTTGGGCTCATAACCAAAAGGCTTGGTCGCTTGATGGCAAAATGCAAAGTGATTGATTTAGGTCCTTAGTTCGCAA
ACTCCTTTGCTACCTCTAAGCCTACTGGATTCTCTACTGGATACACTCTACTGGATTCCTTACCGGATACTGAGTTGCTTCAGCCAATCAGCGACTGCCA
CGTGGATGCCCATCTTGTACCCACAATCTTGTACCCACGTGTCCCGTAATCCCCGTAGCGTAAACAGCGTCCCATCATCAGTGTCCCGCGTCCCATCATC
AGCGTCCCGTCAACACAGGAATGATTGCGGTCCCACTGAGTGAAGGTCATACCGGTATCCTACCGGTATCCCGCAGCTGCCCGAGGCGCCTTCTTGACAA
CAGCTTCGTCTTCTTCCTCTTCTTCGTTGTCGTCTTCATCCGACTGCGACGAATCTTGATCCGTCGTCTCTTCATCTTGAATGACCACCACCTCCCTCTG
GTGGTAGTCGCGTCTCCCACTGTCGAAGACGTCCTCCATGAACTGCGCGTCGCGGCTCACCAGCACGCGACTGCTCTCCAGTTCTTCGAATCGATACGCT
TTCTCGTGCTCCGAGTACCCCAGGAACCGACAGCGCACCGACCGAGCGTCGAACTTGGTGCGCTTCGCCTTCGGCACGTGCACATACGCGTGGCAACCGA
ACACTTTCAGGTTCGCCAGCAGCGGCTTCTTGCCAGTCCAGACTTGGTGCGGAGACTTGTCGTGGCTGACGGCGCGTGTCGGACACCGATTACGGAGGAA
CGTAGCCGTCATCACCGCTTCACCCCAATACGTCTTGGGCAAGCCGGCATGTTCCAGCATGCAGCGCGCACACTCCACCAACGTCCGGTTCATCCGCTCG
GCCACTCCGTTCAACTGAGGCGTGTACGGCGGAGTGAACTTCTGCACGATACCGCGGTCCGCACAGAACTTGGCCATCGCGCCGGAAGTGTACTCGCCAC
CGTTGTCGCTCCGGAGTGTCTGCACGCGCTTGCCGGTCTGAGTTTCAGCAAACGCCACAAACTCCGCGAGCTTGGCAGCCACCTCGGACTTGTTCCTCAG
CAAATACACCACACAGAAGTGCGACTTGTCGTCGATGAACGTGACGAAGTAGCGCTTGCCCCCAAACGTTGGCGTCTGCATGGGGCCGCACACATCGCTG
TGAACCACCTCCAGCACGTGCTTCGCACGGTTCGGGGACGACTTCATGTAACTCACTCGCGTTTGCTTGCCGAGTGCACACCCGTCGCACAGCTCCCACT
GCTTCACCGACGTCATGTTAATGCCAACTGTGGCGTTGGGTTTTGGTGCCGAACTGTCACGGTTTGGCTGACGTTGCACCTTTCAGTGAACGGCGACAGA
GCGTCTTGATTGGCGGGTCTCATTTCCCGCGCTATAGTGACCTAGGAACAATAGTGACCGAGGTCTCGGCTGGGTCTAATAAAACCCCGGCCGAGGTTAA
AAGCCTCGTTTGTACCCATTTCGTGTCGTACCCTCGGCTGTGTAGAGCCGGCTATACGATTTCCCACAGAGATCTGTGTACACTTGATATTTGTATAGAG
ATATAGGACTAGCCAAATGATGACCTACAGAGGCTCCCAGAGCTGTAGGATAAGAGAAATAAATCAGCAGTCTTCCCCACAAGCCACCAAGGGTCAAGTC
CGTCTTCGGTAAGTCTAGCTAGCTTGTCTTAGGGTCTGGATACGCTCGGCTGCGTGGGATGCCTGTCAGCGAGCTTGAGGTACATTGAACCGAGAGTTTG
TTGCTGGTCAGTCCAAGAGATAGGAGTGGCCGAGAGTTAGGGGCGACAAGGAGTGTCGGTCCCTATATATTGGTGGAACCCGAGTGTTCCCAAGTGTATT
CCACTACCCGCCGAGGTTACCCTCGGCAAACCCGTATTAGGCGTGACTGCCGGTACCCTTACTTCTGAGGGACTGCGGGGGTTCGCGCGAAAGCGCAATA
TTGCATTCTAGCCCTCGCTCGTGGCTAGTAGTGCAGGTTTTAAGGTTGACCGAACTCAACCTTGGTATACAGAGGCGCTTACAACCAACCCGGTGTAAGG
GATCGTTCCTGGTCTTCAGGTGTTGATCCAACGTTCGCTGACCTTTCGCGAGGGAAGCGTGTGTTGTTGGTGGGACTCATACCGTTCGGTAGTGAGATTT
TCTGCGTGTTCCTACACGACAACTGGTGCCGCGACCCGGGATTGGTGTGACCTTCTGTGTGTCTTGGTTGCATATAGGTTCTTACCTTAACGAGCATTCG
AGAGAAGAAAGAAGAGAAAAGAAAGAAGATGGCGAAAGAAGCGAAGTCAGCGGTACCAGCAACGCCGGTGAGGTCAAGTGGGACGCGTACCGAAGGTTCG
GGACGTTCCGGTCCGTCGTTCACGACGCCGAGTACGTTGGTGTCGATCAACGAGCGTTCGGACAGTTTTGATGAACCGATGGACTATTCTGACGCCACGG
AAGATGACGAAGAAGATGACCTGGAAGAGAAGGCAGCAATGCCCGAGCTTTCGGAAGCCGCTGCAGTATCTGCAGGACGCAGCGGAGGAGTGAGGTCGCT
TGCGCGAAACCTCACCGAAGAGTTGAACGAAGTGGCTGGTCCCGAACCAGCCAACGGTTACGACGAAGATGGGTCCGACGAACACCGATCGTCGGCGATG
GCCGAGGATGCGAATTCTCGGCCGAATGGCGGCTGGCCTCCTCTTAACGGAGACACCCCGGCCGCCAACCGAGTTCTGGGTCGATACCTAGAACTCATGA
AGGTGAAGAGCAACTGGATGCGATCCTTCGCTCCAGAGGTTGTTCGCCAAGCCATCTGGATGGAGCTCGGTGGCGAGTTGACTGTGCCCGTGGAGTCGTG
GAATACTCGGCAGGTGGCCGAGGACACGGTGCAACTCCTACGCGCTATGGGATGTGAACCCCAAGTGTTCCCGTCGGAAGCAGACCTCCGAGCATGGGCA
CCCCAGGACGCTGCTACGGCGCTTCGCAAGTGGAAGCAGAAGCTTCGGTCGGCCTTCGGGGTGGCCGAGGCGGGAGTTAGCCGTCCACCGAACGTCCGCC
ACGCATCGGATCCGGTCGACCCGTCCATGATTCCGTTGCCAGTGACCCCTGGGAGACGCCCCAGAGGGTCGACCGAGGCCGGAGTATTTTCGGCCCAAGG
GAGCGACCTCGGCATATTTCCAAGACTCTCACATGGTGACGCCGAGGTCGGTCAGTCGCACAGAACGACTGGCGAGAGAGGCCGAGGGATATCGAACCGC
TCCGACTGCTGGACGAAGTGCAAGTCGGACGCCCAGCCGACGTTACGACCTCCGCGATGACTCATCTGACGAAGATTCGTTCGACGTCGGAGACACCGGG
GGTGACTTGACGGGAGAATGGGCATGCCAAATTCGTGAGCTGAGCGCTGTGGAGAATGACAGTGCGACACCGAGGCTAGAGATCGCTACGCATCTCCCAC
TCGGAAATATCAAGCCGTACTTGGGACTCCGCGACAAGAGCGAGAAGTCCATGCAGTGGCTCCGAGCGTTCATATACGAGATGAAAGGGACGCACACGCC
GCCTAACGAATGGTGCATGGCGTTTGAATTGAGCCTCCAAGATGGTGCTCTGCATTGGTACCGACAGCTGCCCCGCAAAACGAGACGCACGTGGAAATTG
TTGAGCGATGCGTTCATTAAGTACTACTGTTCGAGGTTCAACCAGTCTGCGAAGGCTCGGTACTACTCGGCCAAGCGAGAGGAGAAGGAGCATGTCTGCG
ACTACCTCAACCGACTTAACGGCTATGCTCGCAACGCCGGAGTGCAGTTCGAGCATGGCGGTCGTGATGCAAAGGACCACGTCGAGCATTTCTTGGATTC
GTGCGAAGACCGAGGCCTAGAAGAGCGTCTGTGCCATGTCCGAGTTAAGAACATTCACGACCTCGAGGATATGATCAATGATATCCTTCGTCGCAGAGAG
CGAAAATCGGGACGCGAGTCCTCGGTCCGCCGCCCTCGAGGGCAAGAGATAGCACGCCGACGCGATGGTGGACGCTCCGAGGATCCGCGGGACGGCTATC
GCCGAGACCGACGTCACCGAGAGGACGACCGTCGTCGAGAAGACCGTTACCGAGACGATAACCGTCGCCGGGATGACCAACAATATCGACCGAGGGTCAC
TCTCACTGACGCACTGACCAACATAGTGACAGCACTGAATGCGGGACGCTCGGTGGACGCGCGTGGAGGATACCCGGAAGCGTACAACGACGGATATGAT
GACACCGAGGAGTATGGGCCGGAGTCTCACTCTGGCGATGACGACCGATACTCCGAAGGGTACTCGGACGACGGATACGCGTCGACCGAGGACCGAGGCC
ACGTGGCTACTGCAAACGACTCTGAACGTCACAATGCGGCTGAAGGAACGTTCGCTCGCGCCGACAACCGTCGGCCGAGGGCAAGTAACGGCCAACGCCC
GTATGACCGAGACGACCAGCGCCGAAACTCCACCGGACGCGATGGTCGACGCCAATATGTCCATGCGCCGCCTGCGGAGGACTCACCCATTCGGCTCACT
ACTGCTTTAAGCGATGCAAGATGTGCAAACAGGTTCATGATGCCGGGAAGTGTGAAGCCTTCCAAGAACTCACGAATCTCCTCCGAGCTAAGGTCGAGAA
GAAGGACCTCTCGCCGGAATTGCAAGAACTCGTCTATGGGAGTCATTTAAACTAGGCAGCCCGCCAACTGAAACTGGGTTGGTCCCAATCGGGCTGCCAC
AGTTAGCCAAACCTGCGTTGGATGCGGACTATATGTTCGCATTCGCAGGTGTGAGCAAACGGCCTGATGACTTGAATATGGAATATGTGAAAACGACGGA
AAATGTAAAGGAGAGAGGCGTAAGCCTCGGTGAGAGTGAAGTGAATGGGCGACGTGTGGACGGAGACGGAGTGGAGCTAACCGATGCTTCGATCCTCAGC
ATGGCCAAAATCGACCATCCATACCGAGACCTCAGCCAGACGATTAAACTGTTATCTGGCGAGAGAATGGGGTGGTGGTCATCCCAACGCTATGACAAGA
GGAAGCGATTGCGAGCCCTCGTCAATTGGGCAGTAAACGACTCGCGAACGAGGATTCTGCTGGACACGGGAGCGAATGTCAGTGTGATTTCCGCGTCATA
CGCGAAACGGTTGCGCTTGCGCGAAGTTCCAGATCACGGTAGGAGTCTGGAAGTGCGAGGAATTAACCCAGGGGTGATGGAGACCCGCAGACGAGCACTC
GTTAAAGTCACGCTAGGCTGGGAGCGCGTGTACGAATTTGAAGTATGGGTTATGGATCACAGTGCAGGAGTGGACGTGGTCCTGGGAACAGACTTCATGA
TTCCAGCCGGAGTCCGGTTGGATCTGTTCCACGGTACTGCGAGACTACCGGACGAGGTAATGGTGCCCCTGGTGAAGTCGCAGAACTCAGCAGAGGCCGA
GCCGTACAGCATGCAAGTGACTGGACGCCCGACCGAAGATTTGTCGGTCCCAGGGCGTGAGTGGCGAGAATTTAGGTTACCACGACGACGGCCGCCTCTG
ACTACTCACGATGTGTGGGCACGCCGGATTGGAAACCTGGTGCCCACTGTAACGAGGTCTCGACGAGGGCAGCCGACGATGGTGCGACTAACGAACGTGT
CACCGAAGATTGCTCACTGCGCGAGACACGAATCGGTACTGCTGTGGGTGAAAAAGGGTGACCTGCCGCAAGGAGATGGATACACTCGTTTGAACTCCGC
TAAGTATGAGGAGTGGCAAGTCCTGGCGTACGCGGAGTGTCGAGACGAGACTTTGTTCACGCGGGAACGCAAACTCTACGAACGATGGTTGGCAGATCAG
CCACCAGCTGTAGAACGACGAGACTATCCGACACCTAGCGGCATCCTACCTCGACCATCCGACGACTTGGAAGGCCTAGACGAGGGCCAGATAACGTTAG
CGAATAGGAACACTGAGGAACCGACAGAACGAGACCGAACGCCGTTGACGACTTCGGTGCAACCCTCTGACGAACCCGTTGGAGATAGATGGGTCGACGA
AGATGACGACTCGGTGGCGACCGACACCTCTGATGGCGCGGATACCACGTATACGAGTGAAGAGAACTCCATCCCAGTCCTCGGTGATGACCCGGAGACC
CGATTGGACTCTGCCTTCGTAGCAATGATGCATGAGATTGCCGCGGGGGACGGTTCAGGTAGTGGGAACACCGATACCAATACGTCCGAACATTTAGCGA
ATGAGATCGAGTTGACGGACTATGCACACGAGTTGGCGTTCTTACCGGACCTGACCGAAGCCTCGGAAACGGTACTGGATTATTCAGGACCGAATGTTCT
GAACCCGAGCGCGACAGCCCGTCAACAAGAAAGTCTCGTTGCGGTGCTGAAACGACACGAGAAGATCATGATTGCGAGTGGGAATGCTCTGCCACCACCG
GCCTACGGTGTGGTGTGCGATATTGACGTACAGGGGCATCCACCCATCAAACAGAGAGCTCGGAGAACACCGCTCCGACACCTTCGGAAGCTGTACGAGC
TTCTGAAAGGCTTGCTGAAAGCTCGTCTAGTGGCGTTTTCGGACAGCCCATGGGCGTCGCCCATCGTGATCGTGCTCAAGAAGAATGGAGTTGATATTCG
GTTGTGCATCGACTACAAGCTGGTGAATGCAGTGACGGCGATTATGGAGTACGCCATGCCGTTAGTCGACGACTTGTTGACCGACCTGGAAGCCTACCTA
TGGTTCTGCTCACTTGATGCGGCCAGTGGATTCTGGGCTATTATGATGACGATGCGGGCCCGCAAAGTCTCGGCATTCGTCTGTGCACTCGGACATTTCG
AATGGCTTCGTATGCCGTTTGGATTGAAGAATGCACCGATGATTTACCAACGAATGATTGACAATGCTCTGTGGGGTTTCGTTCAACCCAAAGGCGGCTG
GCTCCACTTTTCGGAGCTTATGCGAACGGCCGAAGCCCACGCCGAGGTTGCGCGGACAGGGGTGACCGACCCTTCATCGCGACAACTTGAGGAGTCAACA
ACTCGGGTGACCAAATTCGAGGCCGACCGCGAATCCTCGGTCACGCTTGACGCAGTGAATGGGTTAGTGAACAGCCCTGTTGCCGACATGTTCTCCACCG
GAGAACCGGATGAATCCTTGTTGGTGCCAGTGTTCGACCGACGGTCGTTTGTCGATGACATCTGTTTTGGGTCCGAGACTTTCGACGCGTGCCTGGAGAC
GCTAGACCGACTGCTCCAACGGTTCACCGAATGTCGCATTAGTGTGAGCTTTACGAAGAGTATCTTCGTCCAGCCAAAGGTGGATTTCCTGTCACACGAA
GTCTCTGCAGAAGGTATTCGAGCCGACACCAAGAAGATGAAAGCAGTGACCGAGCTGCCATTCCCTGCTTCGAAAAAGGGGATGCAGTCTTTCCTCGGTG
CGCTGAATTATTACAGTCAATTCATCCAGGATTTCGCAGTGTATGGAGCAGCTTTGTATCAGTTGAAGGATGAAGACTTCACACCTAGTGGCAGCCTCTC
GGCGGCCAAGCGAAGCTTCGCGGCACTCCAACAGAAGGTTGCAGAGGCACCGATCCTCCGGCACTTTGACCGAGACAAGGAGGTGCATGTCACGTTATTC
GCGAATGAGTGGGCATTGAGCTCCACTTTGATGCAATACCATGATGACAAGCTGCACCCAGTTCGATTTTGTGGCCGAGTCCTCAAGGACGCCGAGATGA
ACTACCACCCGGCCGAGAAGGAGGTCTTAGCGCTACTGCTGGTGCTACTCCCAGTTGGTGGGTCGGACCATCCACGTCTATACGCGTTTTTCGACGCTCG
AATGGGTGCACAAATCTAAGACACTGTTCGGTCGAGCGACCCACTTTGCGGTTATGTTGTCCCCGTGGCACCTGGTGGTCAACCGAGTCAAGGAACGCGA
TTGCACGTTTGCTCAGCTTCTCCAAGCTGGCCTCACAAGCTTCGTGGAGTTGGAAGACTAGTTGGCCCCAGTTACACCGCCGACGAAAGGGTCACCTACT
GCTCGTATGGACCCCCACTTGCTTTATGCCTGCCTACCGAGGTCCTATACCGGATTGGTGATGTCGTTCGATGGTTCGGCCAAGACCGAAAAGAACGGTG
GATATGGCAGTTGCTCGTGGATTTTGTGGAAATTACCAGAATGGACTGTAGTGACGGCTGCGAGTGCTTATCTCGAGACCACCACGGTAAACCTCGCTGA
GTATGCTGGAATGAACAACGGCGTCTCAGCTGCGCTCGAACATGGAGCCGCGGATTTAGTCATCGTGGGAGACTCGAGACTCGCAATCCAGCAGTCCCTA
GG