Description :
From Genome Similarity Track
Location :
Scaffold_2347:77- 1949
Sequence
1872 bases(100 bases per row)
CTTTTATTTACGGGCTGTCAGCTAGCACCGCACCAGGTGCGATGGATGTATTTTTGGAATATTTTCTCTGCCGGGTCCCCGGCCACTCGGAACGGCTGAC
TTCGTAGGCAGGGGGCCCCCGTGACACTGGCAGACCCCAAATGCAGGTGGCCCTCGGACACGTCAGGTCAGTTTAATAGCTCACACTCCCATTTAGATCT
CGGCGACGCACTTTGGAAAGTCGACGCGATCACACACGCGCATCCTAGTTGCCGCCATAGTCCTAGTAGTAGCGTAGGCACAGCTCAAAACAATAGCAGT
CCACTTAGTAACAGCACTTCCACTCGATCGCCCTCGTCTTCATCAATGTCACTCAGGTACAGCCTCCGCATCAACAGCAGTAGTCAACGCAGTAGCAGTA
GTCGTAGTTGTAGCTTTGTCCTCGGATACGTTGTCGTCGCTCGACACAATAGGTAAGACTTTCATAGCCTTGCAAAAATGTGTGAACTTCACCACTGCAA
GTGCCTTTGTCATGATATCGGCCACCATATCATCAGCTCCGATGTGTTGGGTTGTAAGTTGCTTCAACTCCACGTGGCGTCTGATCACGTGGTACTTGTT
ATCGATATGTTTCGATTTCGAATGTTTGCCAGGTTTCGCAGTTAAGGCAACGGCTCCTTGATTGTCTCGCAGTAGTTGAGGTACTGGATGCTTCCAGCTC
AACTCCTTGCATAGGCCAGCAAGCCACAACAAGTCCTTGGTCGCTTCTGCCATTGCTACGTACTCCGCTTCACAGGTACTGAGTGCGTTGATCTCTTGCT
TTCGAGATGCGTAGGAGATGACGTTGTCGTCCAGCATAGTGATGTAGTCACTGATACTCCGTCGATCCACAGGGTCGTTCGCATAATCAGCATCAGAGTA
GCCACTAACTTGCACATCAGTCTGTCTCTTCACATTCATCACTAGCCCGTAGTCACATGTAGCCTTCAGGTACCGCAGCACCCTTTTGGCTTGTGCGAAA
TGCATATGATCATAGCCCGCAAGTTTGGGCTCTTTCTTAGGAGCGACCCTAGTCAGCGCCTCATCCATCTTAGCTCGAGGAGTGATGCTCGCGGGCAAGA
CTCCCAGGATCTCATCTTCCCCTTTCGAGCATTTCACAATCTCCAGCGTCCAAGGCGAGAGTAAAGCTGCCCACTGTCCCAAACGTCCTTGTAACCCGGC
CGACTTGAGCAGCCAGGCTAGCGTAGAGTGTCGGGTCAGGATCCGGATGGATCTTCCCACCAGCAGGTTGTAATTCAGATCCAACGCGCGCAGGAGCGCG
AGTATCTCTTTCTCCACCGCTCCGTAGTTCAGTTCATTCGGCTTCAGTGTCCGGCTGACGAAGGTGACTGGATGACAGATCCCCTCATGTTCTTGTACCA
GAGCTGCTGAGACTGCCCAGTCGCTGGCATAAACTATTACCGTAGGTTGACGTTCTGGATCGAAATGACGGAGGATAGGCGTGGTCGCGATCCTGTTCCT
CAGATCCACGAATGCGTGTTGAGCTCGGATCCACCGAGATTCTGCCTTTTCCATGTTCTGATCCGTCGTCTCTATCCAGACTGGATCCTCTCTCCGTTGG
TCCCGGGGTGGATCCAGCTCCTGTTTCAGGTCCTCTTCTGGCGTCGTACCACTTGGATTCCTTCGTGGATCCGACATCTCCCGGGCCAGAGCTTGTTGGA
TTTTTATCCGGACAGCTGGAGTGGTCATCGCAGCAAAATCTACCTCTCTCAATTCATACAATACCGCGGCAAACAGGGCGTAATCCTCGATGAACCGACT
GTAGTAGTTCAAACTGCCCAAGAAGGATTGCATCGCCCGTAACGACTGCGGGAAGGACAAATCGGCTAACGA