Description :
From Genome Similarity Track
Location :
Scaffold_182:77- 1644
Sequence
1567 bases(100 bases per row)
TTGTTAGTCGCGAGCTTCGATGGATCAGCACGTGTTAAACGTAGTGGTGAGGCTTACAGCGCGATCGTATGGAAGCTCCCCGAGTGGACAATTTTATCAG
CCGCGTCGGAGTACATGCCCGATCTGACCGTGAGCGAAGCTGAGTACCGCGGGCTGTTGCTGTGTTTTGACCTGCTGTCGACTTTGGACCGGGGGCGGAT
CGTGATCTGCGGTGATTCCAACCTGGTGATCCGCCAGATGCGTGGTGAAATAGCGTGTAATGCTCCTGGCCTGTTGCTGTTGCGCCAAAAGGCAATGGAG
CGGCTCAGATCGTGGACGAAACACGAGTTCCTGCACATGAAGCGAGATTGGAATCAGAGTGCAGACAAGTTAGCGAGCGCCGCTCTCCAACGAGAAGAAG
GAACTGTGATTACCTCAGAGGATGATCGGCAGGACTTGATCATGTAGCGGGGCTACACATTCGGTTCACCTCCTACCTTAGTGCAACATGCACTAAGGGA
TACATTCAGGTGACCACTCTACAGGGTGGTCCACATTCATAGCCCAAAGCATATGACTGGTAGAAAGTAACACCTTTCTACCAATGAGAGTCATTCAATA
GATAGGGGTTCTGCCAGCCATCCAATGGCAGAACCTCTCATTAGAAATATCCGTTTTAGGAGGAAACCCCATTTACAATCAATACAGTTCTCATTTAGCA
CCAAAGCTATCGTTCGGTTCCTTTATCTAGGTTTAAGTATACTTGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN