Description :
From Genome Similarity Track
Location :
Scaffold_4345:77- 1253
Sequence
1176 bases(100 bases per row)
GATTCTGGGCTGGGGGGGATGCGGAGTCGGGTGATGATGTTTCCTATGCCTCTGGTTTTCGCACTGTTGAAATATTTGGATAACGTACTCTGAATTGGCT
CTCTTGACATGGCCAGCGGTTTCCGGGTGGTGACTATGACGGATCGAGCTCGCGCGATATCCGCATTCATCACACCGTTTGGACTGTTCGAGTGGAACCG
GATGCCGTTTTGATTGTGAAAAAACGCCCCCCCAGATCTACCCAACGTCTAATCGATAACGCTCTCTAATGGTAATTCACCGCAAATAACGCAAACCCAA
AAGGGGTGGAATCCGGGGAAGATCATACGGAAGTAGATCCATTTGAGGCAGGAGAGCCAGGGGATCCTGGAACCCCGTCCGTGTTAGGACGCAGATCTTA
CATCGACGACATTCTAATCCCGGCGAAATCGTGGGATCAGTTGTGCGAAAGAGAGACATCCCTACTGGAGGCGTGTACTAAGTGGAATCTCCGTATCAGT
GTGGTAAAGAGCTATTGGGGGATGCGCAAGGTAGATTACTTAGGCCATCGAGTCTCCAAGGAGGGATTGGAGGTGAATCCTAAGGACCTGTCTTCGTTAG
CAGACTTGTCTGTCCCACAGTCGTTACTGGCGATACAATCCTTCTTGGGCAGTTTGAACTACTACAGTCGGTTCATCGAGGATTACGCACTGTTTGCTGC
GGTACTATATGAATTGAGAGAGGTAGATTTTGCTGCGATGACCACTCCAGCTGTCCGGATCAAAATCCAACAAGCTCTGGCCCTGGAGATGTCGGATCCA
CGAAGGGATCCACGTAGTACGACGCCAGAAGAGGACCTAAAACAGGAGCTGGATCCGCCCCGGGACCAAAAGAAAGAGGATCCAATCAGGATACAGACGA
CGGACCAGAGTTCGGAAAAGGCGGAACCTCGGTGGGTCCGAGCTCAACACGCATTCGTGGAGCTGAGGAACAGGATCGCGACCACACCTATCCTCCGTCA
TTTCGATCCGGAACGTCAACCTACGGTGATAGTTTATGCCAGTGACTGGGCAGTCTCAGCAGCTGTGGTACAAGAACATGAAGGGATCTGTCATCCAGTC
ACCTTCGTCAGCCGGACACTGAAGCCGAATGAACTTAACTACGGAGCGGTGGAGAAAGAGATACTCGCGCTCCTGC