Description :
From Genome Similarity Track
Location :
Scaffold_40:769965- 772709
Sequence
2744 bases(100 bases per row)
CCTTGGTACCTTGTACCAAATATCCCGGAGTATGACATGTCATACTCCTGAAGTGTGAAGTGTCACACTTCATGTAACCAGGGTACACTTAGTGCTACGT
ACCCCGTTACATCCTCCCCCACTTAGGTTCGGTTTACCGACCAATCAGAATGAAGAGATGTTCGTCACAAACTCTCATTCTCAAAGTCGAAAACCATCGA
CTCGCCGCGCGAGCGCGGCGGAGGCTCACTTTACANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGCCCCCGGGAGGTT
CTCGAATGACCTCGACCAGCCAGCAGGAGGATTTTCAAGCTGCCCAGCGTGTGCGTGGGGATTTCGGTTGCGGCACCCGTCCACCCAGGGAGGCTGCCAT
CAACTCAAGAGGGTATTGGCCTCCCGAGGAGAGCTCTGAGGCTGACCTCTTCTTAGAGCTTCTCGTCGCTCCTCGTGGCCTTGTGGGCGGCCACACTTCT
AGGGGCATCTATGAACGAGCCCTTGTTCAGAAAGAACAGTTGTTCGTCGACAACGTGGAGGCTGCTCGGTGTGTGCTTCTCGCGCCACACCGCATTCCCC
TTAAGGACTTCACGACTTGTCGTAAGAAGCCCGAGACCCGGGGTGGTCTCTATCCTGTTTGGGGATACCCCTGGGTTATGCCCGAGAACTGTCCCACATG
GAGTTTCTGGTGAGGACATGTTCTTGGGCGTGGGTGGAGACTTTCAGTTACTCGCCCCAGCGGAGTTATGGAAACTACATGAAGATTCCGGCAGCTTTTC
CCACCTTCCTGGGACCAGCGTGATTTTTCGGGGGAGGTTTTTCCCCCCTTTTTTCCCCCCGGGTTTATGCTGCCAAGGGACATCCTGAAGCGCGCGGCTT
CTAGCGCTCACGATGAGCGCGGGTACGGTATGTATTCATCATCCGTACCCCGTTCGGGCAAGAAGCCCCGGACTACTTATGAAGCTGCCGCCGCTTCTGT
TCCCAGATTGCGACAGCCTTCGGGCAGTCAATCAGGAGCCGTTCAATCGGCTCCCACGAGTTCTCGGAGTGGGCATAACCCCTCCACTTCACGAGGAGCT
GTCGCTTCCCGCGACACCGTTGCTCCTGGAGGATCCGCTCCACGTGGAAGTGGACATTCTCCATTCCGGTCAAGCAGGGGCGGAGGTGCCCTCGTACGAG
TACGAGTACTCGGCGCCTCCCTGAGAGCCACTCTCGTTCGAGTGCTCCGACTGCGGGTCCGACACGGGACCCTGAGGTTGACCGCCTCCGTCAACGTCTC
CTCGTGCTTGAGATTGCACTTGGCCTTGGGACTGGCGGTAATGCTGCCGCCCAGGCCGGGAATCAGGGCGAGCTCGCTCGTCTTGCGGGTCGCCTGGACC
TGGTGGAGCGAGAGGTCGCGAGCCTGCACCTGCGGGTGGACCGCCGGGCCTCTTCGTCCGATCTGGACGAGGCCTTTCGCATGATCCGACGGATCGAGGC
TTTGTTGCCACGTCCGGAGCCGCCTGCGGCACACTCCCAGACGTACGCGTATGGTGCGTACCCGGCGTACTCAGCGTACTCGGCGTATGGCGCCGGGGTC
CGTTCGTATGGAGCCCCTCCGGCGTACGGTCTTGACCGCAGCCTTGCCGTCCCGACCGAGGCTTGGGTGCCTGCTCCGACGCCCTCGTCGACGACTGTGA
CCGGCCCTCGCTTCGAGGGAGCTGGGTCAAGGGGGGTCTGCGAGTCAGCAACCTCCCTGCGGGTCAAAGTACCGCTTAAGACGTCCGACATAGATCGTCG
GGTGCGTCGTCATAGACTTTGGAAGGTCGATGGTGTACGACGCCACCATGTCTGGCCAGGACTGCAAAAGGTCCGATGAAGCGGTGCTTTCAGCTTGTTT
GCTGCCGACAGAGCTGACAGTGTCTAGCGGGTAGGTTCCCTCGTGTCTAATAGCACTAAGTCCCCCACTTTAAATACACTTAAGTTTCCTCTTCCATGTT
TGTCTGAGTACTCCTTTTGTCTATCCTGGGCCGCTGCCATGGCA