Description :
From Genome Similarity Track
Location :
Scaffold_553:7698- 10571
Transcript NameFunction/comments
Phyke_g10214hypothetical protein PHYSODRAFT_554371
Phyke_g10215hypothetical protein PHYSODRAFT_475011

Sequence
2873 bases(100 bases per row)
TGCTGCCTCCAATTATCTACGAAGGAGGCTTCTCCATCAAGCGCCAAGCTTTCTTCCGGAACTTCCCAGCCATCATGAGCACTGCAGTCATTGGGACCAT
CGTGTCGGCGGTCATCACAGGTGGAGTGCTGTACTTTGCCGGCTCAATCAAACTGGTGACGAGGCTGTCGTGGGTCGAAGCTCTGCTGTTTGGCACGCTG
ATCAATGCAGTGGACCCGGTGGCCACACTTTCGTGTTTTAACAAGCTGCACGTGCCGCCGTTGCTGTTCAACTTGGTATTCGGAGAAAGCGTGATCAACA
ATGCTGTGGCTATTGCACTCTACCAAACACTGCACAAATGGGATGCTGGTATCGACCTGAGTGCGAAGCAATTGCTTCATGTGGTGATCAATACTGGAGG
AATGTTCGTCGGCTCGTTGCTTGTAAGTGCAGCCATCACGCTCTGCGGAGCTTTCTTGCTCAAGCGAAAAGTGTTCTCTACGCTACATTACTTTCCGAGT
TATGAGATATCACTGTGCTTGATTTTCAGCTTACTCACGTACTATGTGGCGGACAGTCTCAAGCTCAGTGGAATCGTGGCGTTATTCTTTTCGGGAACAA
TGACAGCCCATTACCATTTTAACTCGTTGTCGCGTGAGGCACGTCATGCATTTACGCATCTGCTGCATACAGTGGCGTTCGTTTGTGAGAATGTCGTGTG
CGTGTTCATGGGCACGTCGGTGATCATGATTTTCTCTGGGCATACTGAGAAAAATTCTGGTTCTGCTCTGCGTGTGGATGATATCGATTGGCACTTCATT
GGTCTCACGCTCGTAGCGTGCTTTGTAGCGCGATTCTTCAATATCTTCCCGTTGCTCAGTCTTTCCAACTGGTCCCGGTCGTCTTCTGACCGTATTCCGG
TCAAGTATATGAGCGTGATATGGTTTGTTGCTCTTCGCGGATCCATCGCGTTTGCGCTCGCCAAGAACTGGAACTACGTTGGTTTACATGGAGCGTCGCA
CCGCCAGCTTGTGGAGTCCACCACtctcgtggtggtgctcttTACAACCATTGTGGTCGGCGGCCTTACCGGCCCAGTACTATCGGCGCTGCACCTCACA
GGTCACCATAGTGCGTTGAGACAATCTGACCCCGAGTCAAACTCTGATGACTCGTCGACGTCTAGCGAAGATCGTGCACGAGCAGTACAGCGTGGGTCCC
GTCACTTCGTGCTCCATCCCGGATCCAGAACCACAGAGCTGTTTACGATGCCCGTTGGGGAACAGGAGACTGCGCTAGATGATGACCCAGTGCTAACGTC
GCGTCCACAGTTCCGAGATAGCGttagtgacgaagaggaaggtATCATCAGACAAGAGACTGACCAAGACTCACCAGCAAATGGTAGTCGTGGAGAGACC
CTGACTGGTGCGTTCTTCCGCAACTGGGAGACCTTCGACACCACGTATATGCAGCCTATTTTCGGTGGGCTATCGCAGTCTCGCACCAACCCAAGACCAG
TCGACGAAGGCGCTGAAGACCAACAGCTagccaagatgcagacacAGAGCGACGTCTGATATTTTtttcacacgtcacagaAATGTTATGTTTGTTATGT
GTTTTACATCATATACATCATGTCACATATTAATCCCCATCATAAGAGAGCCAGCCACACATAGTTAAGCCAAGTCACATCTAATACAGACACCGCCCAC
CAAGGATGGAGGacgcggtgctgctgctgctcatgctgttcgtgctggtgatggctTCGTACTTGCTGGGGCGGTACTCGTGCATGCTCATTTCCCAGAG
CAGCTTCGCGCTCATGTTCGGCCTCTTCGTGGGGCTCTTCATGATCATGGGCGGCAAGCACGCATCGCTCCATACACATTTGAACCTGGACAACAGTCTC
TTCTTCAATGTATTGCTACCTCCAATCATCTACGAAGGAGGTTTCTCCGTCAAGAGCCAAGTCTTCTTCCGGAACTTCCCAGCCATCATGAGCACTGCAG
TTATTGGGACTGCCATCGCTACGACCATCACAGGCGGCGTGCTATACCTTGCTGGCTTGGCTGGTTTGGTAACCAAGCTCTCGTGGGTCGAGGCCTTCCT
GTTTGGGACGCTCATCAGTGCTGTGGATACTGTGGCCACGTTGAGTTGCTTTGACAAACTCAATGCACCGCCGTTGCTGTTCAACTTGGTGTTTGGAGAG
AGTGTGATGAACGATGCTGTGGCGATTGCACTATATCAGACACTGAAGAAGTGGGATGCGGATATTGACTTGACGTTCAAGCAGTTGGTACGTGTGGCAC
TGAATACTGGAGGGATGTTCGTGGGCTCGTTGCTGGTGAGCGCAGTGATCACTCTGGGTGGAGCTTTCTTGCTGAAACGGCAGTTCTTCGCGACGCTGCG
CTATTACCCGAGCTATGAGATCTCACTGTGTTTGATTTTTAGTCTACTCACGTATTTTGTGGCTGACAGCCTCAAACTCAGTGGTATTGTGGCGCTGTTC
TTCTCGGGTACCATGACGGCGCATTACCATTTCAATACGCTGTCAAAGGAAGCACAGCATGCGTTTACGCACTTGTTACACACATTGGCTTTTGTGTGTG
AGAACATTGTGTATGTATTCATGGGCACGTCGGTGATTATGATTTTTGCTGGACACGCAGAGGGGAATGCAGGTACTTCTCTTCGGGTGGACGACATTGA
CTGGTCTTTCATCGGTCTAACACTCGTGGCGTGTCTTGTGGCACGATTCATGAACATCTTCCCGTTGTTGAGCCTCTGCAACTGCTTGCGTTCTCCACCC
AACCGTATCCCTGTCAAGTACATGAGCGTCATTTGGTTCGCCGGTCTTCGCGGCTCTATGGCTTTCGCTCTAG