Description :
From Genome Similarity Track
Location :
Scaffold_517:7696- 10386
Sequence
2690 bases(100 bases per row)
AGGGTCATGATATGGCTTAAGCAAGCCAACGTAAAACACTGGGTGTGTGCGCAATTTGCGCGGAAGATTGATTGTACAGGCAAGGTCTTTCTTAGCAATG
ACCGTGAATGGCCCAATGAAGCGCGGACGCAATTTTGGCTTGAAGACGGCAGACACTACATTTAAAGGTTGGTTCCTAGCATTTAATAAGACTTGGTATC
CGACTTCATAAGAATCAATAGATTCTCCAACCTTAGCATGAGCTTGTTCTTTTTGTTTGTCTTGGCTATCAGCCATTGCATCACGCACATGTCGTAAGAC
ACTAAAGCGCGTCGCGAGAAACTCTCTCACTTGTTCCTGCATCGTGGTAGGGCTGATTTCAGCAAGCTTGTCAGCAGACCCTCCCCCATCAAACCCAGAA
CCACGGAGTGGTAACGTGAGTGGAACGCGGGAATGCGTAAGGCTATTCACATAGAATGAATTAAAGCTGGTCGAGGCATGAACAGCGTTGTTCAACGAAA
CTCAATGTCAGGGAGCATCGAGCTTCAAGTCTTAGGCGGATCAGCACAAACACTGCGAAGAACGTCACCAATGACGCGATTAACTCGCTCAGTCTGACTA
TCGGTCAGCGGATGATCCTCTGTGGACATGTTCAATCGTGTGCCAATCACCTTAAAGAAGGAAGTCCAAGACTTGCCTGTGAAGCGAGGATCTTAATCAG
AGATGATTACCAGAGGCAATCCGTGTTGACGAAACACACGATCGATAAACAGCATACCTGTACCTTTGCCATCGATGGAATCTGGCACTGCCGCTAAGTG
AACCATCTTACTCAAACGGTCAACAAAGAGCACAATCTTAATTTTCCGTCACAGTCTTTGGGAAGACCAAACGCAAAATCCCTACTGATAGACTCCCAAA
ACCAAGTAGGTACGGGTAAACTGACGAGTGGCGCAGCCGATTGTGCCGAAGGTTTGACCCGCTGGCACGTTTCGCATGTACGCACGTATGTGCTTACCCA
TTTGTAGATTTTGGGCCACCAGTAGTGTTGACTCACAAAGCCATAAGTCTTTTCCCGGCCCAAATGTCCACTGAGGGCAGTATCATGGGCCTCAAAGAGG
ATTCGATACTTTAAATCCTCATTGTGAGGTACAACAATGCGAGCGGAATCCGCTACATCTGTGCGATAGCACAAGAGACCATTATCGATGAAATATCGAT
GTAGGCTGGTACGCATGCGTGCCGATAATTGACTGTCCGAGTCCTTGTATTTCTCACTCGCAAGGGCATAAAACAAATGCCACACATTGAGGATCCTGTG
GATCTACCACAAGTCTGAACTCTTCAAGAGAAGACGGCAAGGTCGTGACATGATCAAGCTCATAATCGGGACGGAGATATAAGACATCGGCCAACACAGT
TTTTTTCAGGTTTTTACTTCACCTCGAATTTATATTCCGCAAAGATGAAAAGCCAACAACCCATTCTATGAGAGAGGTAGGGCAACTGTGTCTCCGTGCG
TAACAATGCATGATCCGTGTAAATGAAGCATGTCTTGGAGCCAAGCAGACGGACTCTAAATCTAACGAATGTGTACTTCATAGCAAGTAGCTCTTTGTCA
TGAACGGGATAGTTTTATTTCCAGCAGATTTCAGCTGACGAGATTCGAATGCGATAACTCGCAAGTGACCTGCAGCATCTGTTTGTAACAGGACGCTACC
TTATCAAAGTAGGGTGCATCACAGACAACACTAAAAGAGTAATCAGGATTTGGCAACGTCAAAATGGGAGCATGAAGGAGACTCTCTATAATTGCCCGAA
ATGAGTCAGCATGGGTGTTGTCCCAGCGCCAATCTGTGTCCTTCTTCAGAAGATATGTAATGGCCGAGCCATATCAGCGTAATTTTCACTGTATTTGTGT
AAGTAATTGACAAGGCCAAGCCACTTACGCAAGTCTTTTTAATTTTTAAGAATTAGCCGGTCAACTATAGTCTTGACCTTAGCGGGATCCGCCCTAAGGC
CGCGCTTACCAATGCAACATCCTAGAAAATGAATCTCATCTGCACCGAAAATGCATGTAGACGCGTTGGCGTACAATTTATTAGCGCGCATGCACTCTAG
CACAGCTCGCAAATGACCGATATGATTGTCAACATCTGACCGACCTTATTCGGCGCGACTATGGACAAAAATGTCATCAAAGTACGTCTGTGCGTAATCC
CGATGTGGGCGGAAACGTTTCGTCACCAGACGATTAAAGGTAGCCGGCGCGTTTGATAGCCCTTGGGGCATCACCAGCCATTCCCATAGCACACCACTCG
GGGTGCTCACGTCTGTCAGCGGAATCTCACTCGCTCGCATGATCAATTAGTAATTTTTATCGACTAAGTCGAGTGCGCTATACATAGTACAGCCAACCAT
GTTGTTTTATAGGACATACTTTCGAGGAATGGGTGTTTGTGCCGGAATAGTAGCCTCATTAAGCTTGTTGTAAGCATGCACAATATGCCACTTGCCGTTC
GGCGTTTTTACACAAATTGTCAGTGTCGAATGTGAAGATTTATTATCACGTACCATTCCTGTCTCGCGCTTGGCACGGAAGAAGTATCAATGACATCACA
TTGCTCCTTAGGCAAGGGCCACTGTCGTGTGACACAGTATTTAGTCCCAGGAACTAGGTCAATTTCATGACGGACACCTCTATCTGGAGG