Description :
From Genome Similarity Track
Location :
Scaffold_17:76929- 78977
Transcript NameFunction/comments
Physo_344110apoptosis-inducing factor, putative
Physo_344111protein kinase

Sequence
2048 bases(100 bases per row)
GGGCGGGCCCCGCCCAGAGCCCCGATCTCAACCCAATTGAGAACGTGTGGGCGATCATGAAGCGGGAGCTGAATCGCCAGCCAGCAACCTCTATTGAGGA
CCTCAAGGTAAAGCTCCTTGAGATATGGACGAGTATCGACGACGATGTCATTCGCAAGTGCGTGCTTTCCATGCCGGCTCGCCTGGACGCTGTCATCGCC
AGCAAGGGGGCTCACACGAAGTACTGATTTGTGACTTGATTTTTGTATGGGAACGAGGTGGGCGGTGATTTTTTGTCACCGTGTTTTGTAATTTGTGCCA
GATTTTTCCTGATAAAAATACAGCAATGTTACGTTTTTCCTATTCATTGACCTTCACTTGTAGTTTATCCTTTTGCGTGTTTCTCCGGCAGGAAAATATG
ATCTAGTTCGTGAACAGTTGCCAAATATATTAGCTGTATACTATGTGGGCGGTGACTTTCTGGAGCCGCTGTACAGACGCGCGTGGTACACGTCTGCGCG
ATGTCCCGAGTGCCGACTGCCGTTGTGATGGACTGCCACGCCTGCGTGACGCTGGAGCATTGGCCGCCTCCGAACTGCTCCAGCGCCAGCAGGAACCGCT
GCTGCTCGTCCGAAGCCCACGGAGACTCATCCTGTTGGTTGGTGAGAGGTGCTGAAAGTCGTGTACTTGCTGTCTGTGATCTCAGCACGAAGGTGCGGGC
AGAAGACGAACGGAAGGTAGGAGACTGAGGTTGCCTTGGCAGAATGCCGTGGCGGGAACAACCAAGGCGGCGGAGCTGGTTGTGCTCCTGCTGGAGAATG
CGGAAGTGAGTGCCGAGTGCGCAGCAGCTCGGCGCCGCCACCTTGGGACCCTTGCTCGTGTTGAAGGAGTTTCCTAACCGACCTATGCTTTGCTATGCTG
GTAGGTGCTGTTGCTGCTGCTGAAGCTGCTAATGTGCTGCATCTGTCAGTTGCTAACTACTGCCGCGCGGGGCAACGAGAGGTAGTGACCTCCCACAGTC
GCAGCGGTTTCTGTGCTGGCGAGCTTCGCCTGCGACCGCGTGCCGTCTTTCCGCGCTGCGGAGCACTGCTTGGTGGCGCTGGTACCGCTGGTACCTCACA
GTTGGAGACGACGCTGAACGAGCTGAAGGTGGGCGTCGACCCCGAAGTCCGCTTCTTGCCCATCGGAGCGAGTCGAGGAGAGGAATCAAAAGAGCGGCGC
GGGTGACGACTGCAGAAGAGTGGAGAACAGTCGAAGTCGAGTCGAGCCGCCACCCACCACGCGCAAAAGGCAACAAGACAGAAACTGCCGAGCTCAAACG
GAATAACGGACGCCAACGGACGGGTTTCCAGCGAGAAGAAACGGATGAACCGCACTCAGTTGACAAGTGGATATGCCGGGATGAAATTTTGAGAGCTCAG
TCCGCGGCGCATAACGCAGTTCATTATCATCAATAATCTAAGTCTTAATCCGTGCGTCCTTCGACGTCGCTCAGATCACGTCCGCAATGACGGCAGAAGT
GATCTGTCGACAAAACATCCCCATTACAGCTTCCATATGACCGCTTCGTTACCACCGCAGCTGCGTGTGAAGATGTGGGCTCGCTGCAATTACCGCAAAA
GTTGAACTCAACCGGCATACACGCTGTACAGTAGAAACATACCCACATGGTAGCAGTCTCAACTACGATAGACGCTTCTTGGTTGCCAACATTGATCATA
TCCACGTTTAAGCCTTCCGGGCATTGTCGGTGCTCGTTCTCAGTCCGCAAACATCATCAGCGTGTCGATCGCATCCGCTAGGGACATGCGCGTCTCCCAG
TCTGGATCGAGGAGCCGCTCCACGAAAGTCCACTCCTTATCGGACATGCCGACCACGCGGGGGTACACCTCATTATTCAATTTCCTCTCCATCACCGTTT
CGGCTTCCAATTCGTACGGCGGATGTCCCAGGAAAGCCTCAACGATGCACATGCCGAACGAGTTCACGTCGGATGCGAACCGTGGATTGAACACCGAGTT
CGGACTTTCATCCACTACTCAGGCGCCTACCACCGAATAGCGTCTGTC