Description :
From Genome Similarity Track
Location :
contig_6:769237- 775178
Transcript NameFunction/comments
g2366.t1KUF64916.1 Dynein heavy chain 7 [Phytophthora nicotianae

Sequence
5941 bases(100 bases per row)
ACAAGTGCGAGGTCGGCGATGCAGAAGAACAGCAACGCTGCTCGGAAGGCAACCGGACGGTAACCGTCACTGCGCGCATCAATTTCGCGTTCGGTTTCTT
CGGCTTCACGCATCTTCGCCATTACAACGGCGGAGGTTTCTTTCGCCGACGCTAACGTCTCGATGAGGTTTGTATCATCCAAAATGTTACCCTCAGAGTG
CGACAAGAGGTACAGGATTTGGTTTTCGATCTCGTAAAGCTGCCGTTTACCCTCTGCATTTGATAGCACCAGTTCATTCTTCTTGGCTGCGAGCTCGGGT
AATTCTTTGAGCACCACCACACCCAAAAGCTGCTCCTCGAGGCCCTTCATTGTAATCGTAAAATTCAGCAGACTCACTTTCACGCAGACTTCCGGTGCGT
AGTGCGGGTTTGCTAACTTGGTAGTGAGGAAGAAGCGAAAGCTGTCGTTGTACGGAATCACGTTCTCACCTAGTCGGATCATGTCCTGACCTCCCTGTTT
GAATTTCTGCTGCAGCAGCACAGGCTCCAAAGCGGCATCAAGCTCCTCGCCTACGTTCTCGAGTAACACCCATTTGCCGAAGCGCAGACCGTTTTCTAGT
GCACGGAGGAACCCACGGTCTGACTGTTTGACCACATCCATGCCATTGTCACAAAGCTTCTTATCGCGTCCAAGGTTCTTGATAAAGCGGTTAGCTTGTC
CCTGTGGGTCAATTAGCAAGGGCCATCTTCGAGCACGCCCCATGATGATGCCGTTCTGCGTCGAGACTGTATCAGTAGGCAATCCAGCGATCTGCCACGC
GCGCAGTTTTACAGGATCTTGCAGGGTCCGAATCAAATCGCAGCCTGGAGAGTGAGGCACCGCGTGCTTTACGAGAGCTTCATGCCATGAGGCCACAAGT
TGCTCACGGAACTCGGCCGTAAACGCACCCAGATAACTAATCGTGCCGGCTGATACAAGCACGTCTCCCGTGAGGTTGGCGTAGTCTAGTGTGAGCTGGG
CGACCGTTTCCTTCCAGCGAGCTTCCTCACCGCCTAGACCGCCAATAAGTCGTTCAGCATTCTGCAGTTGAACTTGACACTGCACCACCTTTCGTCCGAG
CTCCTCCTTCTTCGCCACAGCACCATTGTAGGACTGTTCCAACTCTGCTAAACGATCGCTTACTTGCTGCAAATTCGCTTGTGCACTCTTCAAAATTGCA
AGCGTCTCATCCAACTCTTTTTGCGCCTGGGCGAGGGCTTGCTTCTTAGGCTCGACAGCCTTGGCCACGAAATGATACGTGTACATGGCGCGTGACCACA
TACAGATTGCAGTACAGGCCTTCGAAGACTTCTCGATTGCCTCCGGTGTGAAGTTCGGGTCTTCCATACTAGGCGCAACTTTCGTGATAATGGCATCTGG
AATGTTGTCCTTGTCGAAACCGAGCAGGTTCTCCAAGAACTTATTCGCATTCGAGAGCACCACCTTCTGTGCAACCTCCCAGTAGTCATTGATCTTTTTG
CCAGGGCGATCAGGGTCAGGCTTGCTCACAGGCTTCTGACCGAAGAGCATGCACACCACTTCCATTGTCAACTTGACACCAGCAGGTGGCGTCTTGAGAG
CTTTGACCTCATCGATATCAGACTTTTTCAACCGATTCAAACATTCCACAGCGGATTCCAATGCTGGTATAGCAGCATCGAGGTCACGTTGCGCCGAGTC
TGCGATTTCCTTGGTGGCGCTGGCTTTGATACTGGCTGCTGCCTCCTCTTTCTCAACCGTTGCCTTTGTCACATCTGCTTCGGCACTGTCCTTCGCGATC
TGGACCATCATTTGCTCCACTTCCAGCTGCGTAGCAGCAAGAACTGGTTGAAGCTCCACAAGCTCCGTCTGCATCGTTGCAACAATTTCCTTGGTTTCTG
ACAGCTTGTCCACGCCGTTTTGCAGACGGCTACGCATCATATTCACTTCCTCTCGCTTTGCAACGAGCACCGACTTAAATGCCGATAACAACTCCAAGTA
ACTTGTCGGAGTCACGTAAAAGTACCTTCGTAAAGTATTGTAAAACTGTTTGGAAGCCTCTTCCACGCTTTGATGTACAATCTTGAACGCCTCCACAAGC
GCTGGAAGCTTGTCGCCGAGTGCTAAGTTACCATCGCTTAGAATGGCAGAGGCGACTGAGTTTAGAGCTTCAGCAGGCCATTCACTGAACCAATCGATGG
TTGAGCAATTCACCAGCGACGGGAACATTCGAAGCCGGTCACGGAACAAGCCGCCCAGGGGGCTCATGCAGATGACCAAATGAATGTTGCGTCGCACACG
GTTGATATACTGCTGGAAGATGTTGGTCTTTGTAGGAGGGAGCTGCCTCTTTTGACAGTCCACTCTGCATGCTGTGACGATCTGATCCAGGTCTTCTGGG
CCGTAGAGATTTGGCACGTTACCAGCGTTCAAGACACCGTTGAGGTCTTCTAGCATGGTCTCATTGACCACTTGTACGTCTGAAAAGAGGAAGACAACCG
GCGTATCTTTCACGCCTGCAAGTAACAAGCACTTCTTGACGTCTTCACGCCACTCGGTGAGTCCATAGCCCTTAACAATCTCCACCTGGAAGCACTTGTA
CCCTGCCATGAACGTCGCGAGCTTTGTAAGACTCTGGCGACCACTACCACCTACACCAAGAAGTAGCGCGTTGCCCATGGGCTGTCGAATGATTCGAGAG
ATGCGCGAAACATGCTCGACAGCATCCATGAAGAGCACGAGCGACATGGGCGACTTGCTCTCTGCGTTGTAGTCGAGTAGGTATTCATCCATAATGCTCA
GCACCTTGTCCACATCAACCACTTCCTCGTAAATCTTTGGATCAGCACCTGGCACCAAGTAGTCGCCGTAGATCAGATGCTCATTTGTCACAACCTGATC
GTACTCGCGCTGGAAAAACTCGTTCGTCGATGAGCGCATGAGCTCGCGGAACCAGTCGTGGTCCTGCAAAGACACCATTCGGTCCTCATAGACTCGCTTA
CACTCGTGCACCCACAGACGAATCAACGAATCCGCTTCCGTGATACGACGACTGTCACCCATGAGGACACCCTGGAAAACCTTCGCCAGATCACGCAGGT
TGAACGTATAGTGAGACTTAGCTGGCGTGGGAAGCAACTCGCGGCAAATCGTATTGTACACGCTGATGGAGGCTCGGACGACATTATCGGTGAGCCGCGC
GACGTCACCAGGGAAGCCTGAGCCCAGAAAGTTACCAAGGATGGTGCTGAAGATGATGGTTTTGCTGTCATCTCCAAGTTCAGCATAACCAACCACATTG
AAGTGGCGTACCAGTCGAGAAGTGATTGGGTTGCGCCCACCACCAGGAGGACCCATGGAGGCTACGAACAGAATGTCGATGATGCTACGGAAGACGAGCA
GCTTGCGGTCGTACCAACCGCCTTGATCGAACCACTGACGCACCAGCTCCAGAGGAGGTTGAGCAAAGTACTTTTCGCGCTTGGGCATGTTCAGATCATC
CACGTAGATAATGTACTTCTTGCCTGCCGGTGGGCCGTAGACACCTTTCCGTCTCTTTTCCATCTTGGCATCCAGCATGTCCTGCGTCTGGTTAGCAGAC
GTCTGCGCTGAGAAAGAAATCGGGATTGGAATGTAGATATCCGCCGGCAGGGACTGCAAGTAGCGCGTGATGTTCACTGTCTTACCAGTACCAGTGCCGC
CAACCATGAGGACGTGTTTGCCGGCGCTCATCAACTCTTCGAGTAGATAGTTGTTGCGCACAGAATCAGCAGTAGGCACAACGATTTCGGCGAAAGACGA
GTTTGCAGGAACCTTGTAGGACTGACAGTGCTCATCCAGGGTACCCATTTGTGACTAGAGAGCTGATAGCAGTAGTCGTAGACCAGTCCCGTAGGCGGTA
GTGGAGGGTTGCAGTTGTTCGCCACCAACTCGCTGCGCAGGAAACTATCAAATCGTACACGACCAGCATCGTTTGTAGAAGCACCCACAGACCAGATCAG
CGCAAAGATGAACAGCGGCTCAATGTCGTCCTTGAACTGTGCGCTCGGTGATTTAGATGCCGGTTGAGGTTCACCGGTGCCATCAGCCGCAGGCTTTTCT
CGGAAAGGGTCTAGTGTACAATCCAGTATGTTCATGAGGCTCTGCGCTAAATTGTTATCCATCGTGGGCACGAGCTCACCCAAGAAAGAGCGAACGAACG
TGACTGACGAATACAAGTACACATCAAAGAGCCACATGAACACGTGTGCGAATGGTGCCACCGATTTTGGAAGGTGTTCGACCCACGAATCGACAAGTGG
ACCAAGGCCAAGTGTACTTGGCTCCATGTAAACCATACCTGTCCGACTAACAGTAGCCGGAGAAGCCACAGATAGATCCTCCACCTCAAACATCATCGTC
ATTTGCTTCGACATCTGCAGCATTTCACCACTATTGAGACAAAGCTTCTTGTTGTCGTCAAGCACAGTGTTCATGTTCTCAATCCAGATAGCATCCACAG
GCCCGTCAAAGATGACCCATTTACGGTCAGGCTTTGTGTCGCTTGCAGCCGCACGATACAGAGTGGATAAAATACCATCCTGCCACTCGTGCGTGTTGGC
ATCAAATTCACCGTAAAGCTGCCCCATCGTGATCGATTTGGGGTTGAGCTGGTATTTGATAACTTTCTCAAACGCGAACCCGGATTCTCCCCGTCGTTTC
AGTTCTGTAAGCGCGTCGGCGAGCACTGCGATGTTGCATGACTTGCCACCTCCAGTAGCACCGACAACCATGAGACCGTGTCGCACGACGATTGTTTCAT
ACAGTTGGATGCACTTGGTGAGGAAGTACGGAACAGGCTGTAAATTCAGGCGATGGGTCTGCAGTTTAATCACACTAATAAGCGCACCAAGATCAAGGTT
CGGACGGCATTTGCCAGGGAACAAGTCGCTGATAATGCCGTTGAAGAGCGGGATATCGTGCGCCAAGAATTTCGGTAGATTGACATCCTGTAGCGCCCGA
AGCAGCAACACGTCTTCATCCATGTCGGGATCATCGCGCTTGAGATTGCCTGCTGCTGTGATCACCGTTTTCACAGCACGCATGCCGTAGTCGTAGTGGA
ACTGGGACGAGAGCTGCTCCGAACAGAGCTTGAACGTCGTCACCATTTTTGCGCCAAGCGCACGTGCATCCGAGAACCCGTAGGCAAAGAACATGATCTC
ACCAATAAGCGCGTAATCGGGGACCATCATAGCCACCGGTCGAAAGAGCGCTGCAAGCGAGTCGGGTAGTTCACTACGCCCAGCGTAGCCAGGATTCATG
GTAATGAACACACCAAACTGGTCGCTCAGCTTGATATCCGATCCTTCAAACACGATTCGTGTATCGCCGCGACGAATGCCAAGCTGCAATGTGACCACCT
GCTGTCCTACGACCGACAGCACTTCGATATCGATACGGTTAAACTCATCGAAGCACGCCCAGGCTCCACAAGACGCCAACCCCTTGAAGAACTTGCCCAT
GGCGATGTAATCCAGACCATCAGAGCAGTTGAACACAACGCACTGTTTGGCCAGTGCCTTGGCCAAATCCTTGGTAGTTTCAGTCTTTCCTGTTCCAGCC
GGCCCAGCAGGTGCCCCACCTAGGATCATCTGAAGGGCACCCATCAGTGTGAGGTAGCATTTATCCGTCAGCGGCGTGATCACCAGTCGAAACGAATTCC
CCAAGTACTCGTAGCCGTACGGACGTCGTGACGTCACTGCTTGCACCCACAGGTTCTTGTCCGCCCAGTAGTATTTTAGCTGAGAGCTCCACAGAAAGTC
TCCCTTCGACTCCACATTTTGAGCTACAAGTTTGCGAGTGACATCTCGGGCGTGCACATCGATAACCGTCAGAGCACCACACGTGATGCGAGCCATATTA
TCGAGGTTACCACGCACGAGCGTGACCATGTCAGCTAGCTG