Description :
From Genome Similarity Track
Location :
Scaffold_412:7692- 20426
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_412-snap-gene-0.11Brefeldin A-inhibited guanine nucleotide-exchange protein
Pytul_var.sporangiiferummaker-pug3_contig_412-snap-gene-0.12Brefeldin A-inhibited guanine nucleotide-exchange protein
Pytul_var.sporangiiferummaker-pug3_contig_412-snap-gene-0.13C-MYC promoter-binding protein IRLB
Pytul_var.sporangiiferummaker-pug3_contig_412-snap-gene-0.9Nuclear distribution protein nudF
Pytul_var.sporangiiferummaker-pug3_contig_412-snap-gene-0.14Conserved gene of unknown function

Sequence
12734 bases(100 bases per row)
CGAGAGCTTCGACGCATCAGTGTCTTCATCGCAGACGACGCAGTTGCTACCACAGATGAGGATGTTGGTGATGATGGAGTTGCGAGCCCCTTGGCTGCGC
CCAAGTCCACTGAATTATCCTCATGTGTTGACAGTCGACGAGCATTCCGATTGATCTTCTTTGCGGCTTCGGCGATAGCGTCTTCGATTACTCGAATCCA
TTCGGCCTTGGCATGAGCACTTTCGGCATACACAATAAACGACTTCGTGGGGTTGAGGATCTGGAATGCGTGCTTGTGCATGACGTTATCCGGGATATCT
CCGATTCTTGTGAGCTTTAAGCGAAGCGAGTTGTGCGGATTCCAGTAGTGCCCCGAAATGTTCTTGTCGGCATACAGCAACTGATCATTGAACAAGAAAA
AGCGGTATGTTTGGTTCCGAGACCGGCATTTTTTGGTCAGGTCACCCTCCCGGATAAACCGTGTCGTGTCTTTCAGGTAGATGTGGCTCCGGTTTATTCG
CTTGATCACCAAGCTGAGCTCCTCGGATGTTTTTTGACGCTGGATCATATCTTTCATCCTCTTGATAAGTAAGTGGATGTCACCCATGGCTCGCCATGNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCATCCATGTCTGTGACTCATCCGCTTCGTTGTCGCCAGTACTGTTTTCGTCAAGAGTGC
TCTTCACCTTGGCCAACAAGCTACAAAATGCTTGTCTTTCGATAGGCATCCCTAAAAACAGGCACGTTGAAATACTGAAGCGAAGTAAATCCAAGCAGTG
CGTAGTCATCGTCAAATCGGATTGGTTGTTGCAGAGAATCGTCGCCGAAAGCGTGAGCAGCTGAAACCAGATGCGCTCGAAAAGTAGCTTGATCAAATCG
GGGCTGATGCATGCATCGACACCGACAAAATTGAAGGTGTAGTAGGACTGGCTGAGATCCTTGAGTAACTCTTCAAACTGCGCGACTGATCTGGACAAAT
TTCCTCGAAACTTGTCACTCTCCAAGTCAATCAACGACGAACTCGGCTCGCGCGCTTTCGGAGTAAACCGGGTGCCCTTGATGTGCATCGGATGGTGAGC
GATGTCTTCGTAGATTTCTTCGAGGAATCTCTTGGGTAAGTCTTTTCCATTGTCGATTCCGCGGTTATTTTTGACGAATTGCTCTTTGGACATCTTGTTC
TTTTTCACCTGTGGATTGTGCAGATCTGTATTGAGCATAATGATGGAGTATGCGATAATCATGGCCGTATCGGCGGACGAGAAAGATGCTGGGGAGTCCT
CATAGTAGCACTGTGCAAATGCTTCGACCATGCGCTCAATCTTTTGTGCTTCTCCAGGGAGCCGAAATCCTCCATTTGTGAGAAAGTGCCGGAGCGATTC
AACGAGAGTCATTCCTTTGAACGATATCGCTCTCACATACGACAACCGGACTTGAACTTTGAAGTCTTCGTCGCCTTCGCCAAGATAATCGCCAATCTCT
GCTTCGTCAAACGAATCGTGGTACATCCGGAGGAACGACGTGACATCCCGAGGTGAATCTTTCACAAAGTTCATTGCAACAAGGTACTCAATTGCCTTTT
TTAGGCTTTTCGAGGACGCAATTTCCTTCGCGCGTAGTAGCAGCTGGCGATTGCGTTCCTGGAGTTCATTTCGCATGCGTACTGACATGCTGGCAAACTT
TGGCTTGCGGGTGTCATTGCTCGTAGACGAATCCATTGGACTTTTACCACTGATAGGAGAACTCGGTTGGCTTGTAGGGTTTGGATTTTCGTGAACGCCA
AGCGCCACTGGGATGGTTGGCGAGGTTGATAAAGTGGGTACCGATGGCAACGACTCGTCTCCTGTTTCATCTTGTTCCCAGCCGCCATTGTCCATGGATA
AGTGGCGAGTTCGAGCATCGCGACTGATTAAGTGGGCATGACCACTGGCATCCATCACGCTCCGCGCAATCGCTAACATCGCAGTGATAGCTTCAATTTG
CAAGTTCAACGCAACGTCTTTGCTTTCTTCGGTGCTTGCGATGTGAGTGTTGGTACCCTCAGCGATGGCACATAGCGCACAACACACTTGCTCGAAGGTA
CTCCACTGGTGGATACGGTCCATGTCAAAGTTTAGAAAGAATTCCACGACGTTGTGAGGAAGCTGCATCCATGGTGTAAGTTCTTGCATGATGTCCATCT
GATGATTTACTGCACACACGGCACTGCTTCGGAGGATTCTCAAAATTAGATGCTCAAACAGCAGCGCAAGCTCAACTTTCAGGTGCCGTCGATAATGGTT
CCACAAAGTCGATACCAATGTCAGACTTGCTCGGAAGACATCAGTGGACCAAATGAGAACGATCGAATTAACCGTTGAGAAGACAAAGCGTCGGACGATT
TGGCCGAAAATCTGGCGCTCCTTCGTCTGTGTTCCAGCTGCCAAGAGGGCGACGTTTAGACCGCGGAGTGAGTTAATTATTGAAAGCTGATCATGATCGT
GTCCATGTTCGGTAGCATTCGCTACTCGACGGTGTACAGCTTTGCTCAGAGTGATAATAAGCTGAAGGGCGTTCATCTCCGCCTGTCAAAGTTCAACACA
CAAAAAAAGATTACTCTAATGTCAACAGTATCGAGAAGACAACGTGCGCACACACAATGAAGTACTCACGTCCGACTCGGCAATATCACTCATAGATGCT
ATCAAGTCGGTGCAGAACGCTGAAGAATGAATCGAAGAGTGGCTCTACAAGCAAGGAATTCGTCGCTTTGTTAGAGATTCACAACCAGAATACTAATGAA
CGACTGGCTTGGGAGGATCTACTAACCTTGAAAACCCCGAGCATTCTTTCGGTGATTTTTGCCGTTTCACAGCCGGAGCTGATGTCATCGATGAGGTGAG
TGACGATAGATCGAGCGACTTCATTCGAGTTCCATGATGAAACTCTTGCTTGAGCGCGCTTGTTTACGGCAAGCTCGTGTTGGCACTGATCGGATTCGTA
ACGACTCATGATGTTGTACACGAATTCATTTTCCACGGATTTTACCAGCAAAGAATCGAAATCGCCGATGAAGATGATCGACTTCAGTATGGCATGAAGA
ATCGCGGGGCCGAAGCCATTCGGACATTTTCGGACAACCTATGTCGGCAATGTTGTAAGATGTTGTAGTCAAAACTTCAAATGGTACTCATGCGCATTGC
AGGTGGAAGAAACGGTACCTTTCGGAAAAACGGAAGCGCTTGTGCAAATCGAGATTTGACTGCTTGGTGGCAAATTGAAGCAACGGCGTCGACGATCACC
TCCAAGCGGCATGCCTCGGAGACAATTGCTGTCTCGTCAAATATACCTGCGTCCAAGCATTGCGAAAGTCCTTGCAGAGCTGCCTCGGCAGCTGGCCCGT
GACGAGTGTAGCAGGCGAGCAGAAGCGGATACATGTAATAATCCTGTGCATCTTTCCAGCTGAATGTTGGGTCGACTTCGGCGTCTGGTGGCAATGACCG
CAATCAGAGGTTTGCACTTGATGATAAGCAATATACACTGACAAATCATTCGTACCGTTGATTTCGCAGGTGTTTATGAGAGTCGAAGCTGGAGGACTAG
CTGGTTGTGTATTTCGAAGCTCGATTGACTTGGTCATTGAAGTGGCTGTTGGGGTCGATGGGTGCGCATGGGATACTAGGTGGAAACCCGCTACTTTATG
CTTCGGCTGCACTGGTGGCTGAAGGTGAGTGCTAGTGCTCAGTGGTTTGTGCCCTGTGTGTGTTATTTGGAGCCATTTCATACGTAGCTCGGTTAACGAG
TTTAGCTGCAAAACGAGGAGAAATGGTATGAAGACGCGATTGTTAAGAAAGCTGAGCAGCAGGTACAGAACTGCAAAAAAGGCACAAGCAAACCGTTTTC
TTGTAACACAGGAACACTTCTGTACCGCCAGAGTTCATGTTGAGATCGGCGACGTGCCCATCTGGCGATTTGTCAAGTTTCATGTAGCTGCAAGTTCATA
TCGAGGCATCAAGTCAGTGTCCATTTGTGAGTCCCTGGTGACGAAGTATGCTCTTGCTAACGTACTTGTAGGGAATCTTCTCTCCTTTCTTTGGGAACAG
CACTGTGATGTTGACAATCGAAGACGTTGCTGACCGCTTGTAGCACAGCAAGATCTTCTCACCCTGTGTTCCCTGATCAAATTAGTGCGATAACGACGAT
TGTAAGTACAGCAACATTAGAATAAAGCGCTCCAATCATCATGTCTGCTCTTTTTCGAATCGTACCGTGTTCAGGTTCGCAGGGAGACCTCGCCGTTGGA
CGACTTCGTAGTCGGTTGGCACAAACTCGCCTCGTTCAGGATAAATGGCGATGATTTCGCTGATCGGGAGCTTGTTTGACGATTGATCTTTGCTTTGGCA
GAGGTAAACAAACACGCCTCGAGCGCCTTTGTTCAAATCGGCACGCAACCCACTTGGAGATCGCTCCAGCTGAACAAAAGCCCAAAATGAAAGCAAACAC
TCAGAAGCTGCTCAAGTAGAGATGATGAACCGGAAGACCAGCAACATTAGAAACCTTGCTAAATCCGTCCGGCACCGTGTCGCCAGTGAACATGACTGTC
AAGTCCGTAATCGGCATTTCTTCATCTTGCTTTTTCCGTTGGCCGGCGTGTTCGTCCGTGCTGATACTACAAATTGAGGCAGAAGGCAATCGTTTGTGAA
CATAGCCTTGCTAAACGCACAAGCAGCCTGTCGTACATACTTTGGACTCAGGCGTCGCTGATAAGTGCGTTTTCCTTTCTCGATAGCGTTCGGCACTAAT
GCCATCAATCTCTCTTGTGGGCTCTTTGGTGGCATCAGCGTTGCCTTAGCAGCGCTCGCACTTTCGTCCGTCTCCGATGCAGCGCTGCTGGATGCCAGAG
AAGTGATCCTGCTCCCATTCCGTGACGATCCACTTGCAAAGCCCGNNNNNNNNNNNNNNNNNNNNNNNNCCGCTGCCGTGAATGCTCAAGATCATCTCCG
ACCTGTTCCGCGCCGACACACGGTTGCTGTGCGTGAGCGTCTGTTGACACACTTCTCGTAGCATCGTAAACCCTTCGTCATCCTGCACGGTCTCCTGCAG
CAAAGTGTGGATGGCGTTCCGAAGTATCGGNNNNNNNNNNCAGGTCCGGGGAGCTCCGGAGCAGCGTCTGCGTTATTGCTCGCGCTGTTCGAACTGCTAG
CAGCAGCACCATTCGGAGTGGCGCCGCGTAGCTCGTCTTCAGGGTGCTCTTCGAGGGCCATCGCGAGCTTCATCTTGCCTCGGCTCTTTCGCCTCGCGCC
AACGGATCGTGNNNNNNNNNNNNNNNNNNNNNNNNNNNGGTCCTAGCGCTCATGGCAGAAGCGAATGGCGTTGACACGTGCACTGCGCGCAATGGCAAAT
GCAATTAAAGACGCTCGGTGCTCTATTTCTGCCGTTGCTTCCGTTTCGCTTCTTTTCTCCGGCGCATTGCACTACAAAGTGTGCTATTATTGTTGTGCGA
TGATGACGCAAAAGCACTTCGCGTCGTTTCGCGCATGCCCAAGTGCTCAAAATGTTGCGCGAAAGTTGCGTGTAGCTACTCAAAATGCAGAATGGAACCA
AAGTGCAAGATGAGGAAAGCAATGGCATGAGCGCATGCATGTGCACGAATGGAGGCGCAAACTTCGAGCGCGTCTGCTGCGTCATCCGCTTCTTCCTCTG
AATGGCGCGCGAATGAGCTCAAACGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNGGCGGCGCGCGGCGCAGTCGCTCTTGACGCAGGAGCCAAGCAGCAG
CAGCAAGGCAAGCGTCAATGCGTCGAGTGGGTCTCCCACATCGCCTTCATCGTCTGCGTCATCATTAACGCTGTTGGCTCTGGAGTCACCGCTGTCGATA
GTCATCCCGTCCTCATCGTCGTCGTTGTCACCGTCGCGGCTACAGTCCCAGACTCGATCCGAATTGGGGCAACTGTCAACGCCAATATCGTCAGTGTCAT
TGCCGCAGTTATGGACCACAAAGCATGAGGTTTTCAATCTTCAGATGGACGTGATCGATATGCAGAGCAAACAGGCGGCGTCTATCCGCGCGTGCGACCA
GCAGTTCCAAGTCGAGAAAAGCGTGCGCCAACTCACGTCGGACATCTCGGCGACGCAGCTCACGATCCGCCGTAAGAAAGACGAGCTCGATGCATTGCAA
ACCCGCTTGTTGCGGCTATCGAGTACGCTTCATGATGCGTCCACGGACAAGAACTTTGCAAAGAACAAAGTGCGCCAGCTCGAAGCGATCCGCAAACAGC
GCCATGGGCTGATGCGGTGTACAAATTGCACAAAGGAGTTTGTGCCTGATGTGTTTGCAAATCATGTGGCGACTTGTCTGGCGAGCAACTCCACCGAACG
ATTCGCTGTAGTATCGTGCATTGCACATTCTCGGGCGCTACCTGAGATGAAGACTCCTCGAAGCGTCAATCAGATCATGGATCAGGCTCAAGACATCGAG
CACCACGCCTTGAGTATCACGACCATAGAAGCACACGAGCAACGAAAGCTTCCATGTTTTGTCTCGCAGCCGCCTCGTAACCTTCGAGTCGATGGCAGTG
GCGGTAAAAGTGTCACACACAATTCCATTCTACTGCGATGGGATCCACCAATCTTCACTGGTTCCACGCCGATCATCGACTACGAAGTCCGATTCTCCAT
TTGCCACTTTGTCAAGCGAATGAAAGATGGTGAGAGTTGCGTATCACGGACATTCGAGTCACTTCCACCACAAACAACGTCACGCTGGTGTCTACAAAAC
CCCGTCGCTGCGAATCAGTTCTGGGTGCGAGATCTTACAGCAGATCAGGCATATGGCGCGTTTACCATTTGCGCAATCACGAAAAACGGCAAAAGTCAAC
CAAGTAATCAAGTAGAGCTGATCGCTACCGCGGCTGCGATGCCGCCTTCAAAGCCATATTTCCTCTGTGTAGGCGTCGTGACCGCGAAAACGATCACTCT
GACATGGAAAGAGCCGATGGACGATGGGGGTAAACCGATCGACTTCTATGAGATTTGCTTCAACGAAGCCGTCATGGAGGATACCATACTGGAGCGCAGC
AGTATCAACGACAAGAAGAACAACTTCTTGGATGTTTCGGAGGTAGTATACAAACCGAGACGCATTCGCACGAACTCCAATGCCACGGCGTTCACACTCA
CAGATTTGTTAAGCGGAAAAGAACATAAAAACTTCCAAGTACGCGCAATCAACCAGACAGGCATCCCTGGTGATTTTTCTGATCCAATTGCATCCATTTT
CACGATTGGTAAGTACGTTTGACATCTATCACCTTTAACTCGTCATGTGCCCTTGACCTATGAAATTCTTTTATTTTTTTACTCTAACCATTCTCTCTCG
TGTGTAGCACCAGGGAATGAATTCAAGTTGCTGGATGAACTCCAAGCTGCTGTGAACTCTCGTGCTCGGGTTGTTGACTCGCAGTTTCTTAGTGGATTCA
TGCAGCGTTACGACCGTGACCACTACATCCACCTTGTCTCTCGCTTTATTACATCGCTACATCCTGATATGGAAGGTAAGGTGAACGCGATCTTGAGTCG
CACACGGATAACTATATCGGAAGAAGAGAGTGATGATGAAGGCGGCGGTGCTGACGATGACTCTATCGGTGAGAAGCTACGCTCGAATACACCGAAACCA
CAGTTCGAGGACCTCTTGGAGGAAGAGCAAATCCAAGAACGGCGACGGCAATTTCATTTTCGAATCTCGGAGCTTAAACAGAGACTCAAAACCGCAGACT
ACAACGTGCAATGGTGTAAAGACCGTCGCATCGACCTAGTTGCGCTCATCCGCGCTGCAGAAAACCGGACTCTTGAGAAACAAGCCGAGCTAGAGCGTGC
GAAAATGTTCACCGGACCTCAAATGGACTCGGACGTTCTGGAGAATGGCTTGCAGCGGTTTTACACAAAGGATCTCATCTTTGCGCTCGAAGACGAAATC
GGGATTGAGCAGTTATATATCGTGGATACCAAAAGCGAAATCGTGCAGGTCGAGAATTACTTGCGAGCTGATGAGCGAAAACGGGATGCGATTCAGGCAC
GATTGCAAAATCGAAAAGACGCGCTGGAAGCGTTTGAAATGAATCCGTACGGTAATGCCATCGATAGTACACACCAAGATGTAAAGGCAACGAGTCTCGC
GCGGCTACGGGACGGTGTATTGTTTCGCGCGTTTTCTGCGTTCGTGATAAATCGCGCGAGCGCGATCGAGATGCGAAAGAAAGTGCGCGCTACGTTGCTT
CAATTTGTGAATTATCGTTGCCGAATGGCATTTACCCACTGGGTAACGGTGGTGCGCAAGGTATTGCGCCAATCTAGCGAGGGGAACAAGGGAGGTGCGT
GTGGTGTTGGCAGCATCGCGCTCGTGAATGCAGCACTTGGTCGCGATGATCTGCTGCTGCAAAGCCGAGAACTTCTTCAGCAGCTTCGACAAACGGACGA
GAATCTCAAGAGCCTCGTGTGGACGAAAGAGCAACAAGCCGAGCGACAGCAGCTTTTTTCCGCAAAAATAGACGCCGACCAAGCACACAATCAACCCAGC
CAGCGTCAAGACAAGGTGTCTCCATTTCTTTTGGAGGCCGACGCGAAAATGGATATTGAAGACTTTGAAGGAGCGGCGAGGTTGTACGACTTCGTCTACA
GCAATAACACCTGGATGAACGAAATGCCACTTGCGATGGTTCTTGATTTGCTACTGAAGCTGGGGAAAGTGAATTACCACATGCAAAATTACGAACAAGC
ACTTGTGTTTCTGAATCGAGCCACATTTCTGGCTGTCAAGCTTGGGAAGCGAGGCGAGGAAGGTGCGGTTACGTTGTGTATGGCTCACGTCAACTTTGCG
CTGCGCTCACTGCGGCTCAGCATAGAAAACTATGAACACGCGCTTCTCTGTTTCGAAGCTACAGGGGACAAAAAGGGACAATTGTTGTGCTTCCGAGGGC
TCGAACAAGTACACGGTAAACTTGAGGACACTGAAATGGTCCAAGTGAACAAAGAGCTAGCCGATGAGATTGAGTTCGCACTCGCCACCAAACTCTCGAA
TGCCGGTCAAGTGCTGGATCATTTGCGAATGCGACTCGTCGGTGCTGGTGCTGAATCGTTTACTGAGATCATGTTGGAGCGAGTCGGTGCAATTGTTCCA
CGATTGAGGACGCAGCGCATCATGCGCAAACTAGACATTCACGAAGAGGCAAAGCTCGTCACAAGCCTCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNAAGGCGCTGCTAGCCCAAGGAGAAGCCGATTTGAAGCGTGCACTTGCAAGTGATACGCCGCTGGTGGACTCTAGTGCGATCATTGGTACGA
ACGTTCGGTACGAAATTGAAGATTTCAAAAAGAAGCTGGCAAAGCTCATGGGAAGTGTGAAAGCTGGCGAAGACCACATCACGAAGGAAATCGCAAATGC
CAAAATTCGAATCAGCAACTCAGAAGATGAAATCAAAGAGTTAGAAGCAGAGTTGGGTGTGGAAACGGGTAACCTGATGCGGCAGATGATGTCGAAAGAC
AAACTGCGGTGCTTTCGTTTCAGTGCCACGAACGAGGCACTGAAGACTGTCATCGGCACTGCGAGTCACGGTGTTCCGACATGTGTGGCGACGGCTGAGC
TGACTGGAATCCTATTTGATTTGCTCACTGGGGCGTGTCTAGGCCAGGCGGTGGGGGATCCGCACCGACAGCATTTGGGTCCACCGAGGGGTCATGAAGC
TCAGATCGTGAGTCTATACTACATTGGCAATCGCATCTACACTGGCGGCATGGATACTGCGCTCGGCATTTGGGAAGTTCAGGATGCCGTCATCGGGGGA
TTTTCCGTGACGTTGGTGACAATGCTTCAAGAGTTTGATGCCTCTGTGGTCAGCGTCGTCGCAGACATGCAGCTAATCGTGTGTGGGTGCTCAGATTGCG
ATGTGTTTGTCTTCGATGCAGTCACCTTTGCGATCGTCGCGCGCATGATCACTGCGCATGAGCGAAGTGTGATGGGGATTGCAGTCGACAGTGGCAACAA
CTGGTTTACCACGGCTGGCGCTGACAATCGCGTCAAAGTATGGGAACTTGGACCTCGCTCAACGCAGACTTCGTACCGGAAGATCACATTGCGGTATTGT
CTCGAGCCTGAGCGTCGTGGCGATGAGTTTTTCAACGGCCACCTGCATCCGATTACGTGCATTAAGCAAACGTCGAGCGAGATCGTGAGTGGTGACAGCA
ACGGACGCATCATCATCTGGAACGTTGATGCCGACCGCAAATTGCTGCGCATCTGTGACGTGCACAAAGGTGGCATCCCCGTGACGTGTCTCCAATTTGA
CGCGACGCGAGTTGTGAGTGGCGGTCAGGACGGTACGATCTGTGTGACCGATTTTGCCACGGGTCACCTACTTCAGACGCTTGTGGGTCACAAGGAGAGC
ATCTTGGATCTCCAGTTCGATCGTAAACGGCTCATGAGTATGTCGAGTGACGGGAAACTACGTTTGTGGTACTGGCAAAGTCGCATCGGAGTCGGTGGAG
ACCGCAAGAAGTATCACATCCTTGGCTCCGGCGAGACACTCAAGGCACTTTCGCTCAAGTACCACACGAGTATCAACCAATTGCTCCAGTGGAACGGCCT
CCCCGACTCGAGCCACCTGTATCTGGGTCAGAAGTTGATCGTTGAAATTGATACCAGTAATAGCGCTGCCGCCGATGAGCTCAAGACTCTGGACATGGCC
ATGTCCACGCAATTTGGCAAATTGTCGTACGAAAACCTGGTATTCATGGCTGCCAACAAGGTGAAACGAGCCGATGTGGAAACTCAATGGGGGTCGCAGA
AGCTGGCGATGCTCGCCAAGGAGTATTTTCCGTCACTCGATGAAGACGAGGAGGGAAAGAAAGAAGAGATGACGCAGGAAGACGAAGGCGAGAGCTCGGA
TTCCGATATGGCGCTAGAGTCCGAAGAGGAAGGGAGAGGTGGAGACGAAGAAGCAGAAGAGGAAAACGATGGGAAAGCCAAGCAAGACGACTGATGCTAC
ACACTGCCGAAACAGAACAGCAAACACCAACGGAACAACGAAAAGTCCAACATCAATATGTTTTTGCTTTTTTGCGAAGAGAAGGAAAGAAAGACATGAC
ACAAAACACTCAACCACAATTCTCAATTTCTTGGAAACCAAAGAAAGATGCAAGGAGGGCAGGAATTTACACAACACGGCCGCTATCGTCCTCTGTGGAC
CAGACCGACTTGTCTTCCAAGTACATGTTGCAGCTACGGAACGCCGTGCGCGCATGGTCGCCCGCAAAGAATTCCCACGCCGTGTAGAACCAGAACGCGA
CGCACTTGCGGTAATCATTTGGCTGCACCGATCGCTTCAACGACAGGATCTTTCGCCATTCCTCGATCACAAACGTGGACAAGATGTCTTCATAGTGCGA
TAGACGCAACGGGTTGCGCACCGTGTAGAACGTCGTCCAGTACTTGCCGTAACCTTCAAGTTGCTTCAGACCGTCGTTGAACTCCGGGGAGCGGAACTCT
TCGAGTGTCGCATCGAGCATGAACACGAACTTGTCACTGTACTTGGCCTCTTCGTCGTAGAACTTCTTCCAGGTCACTGAGAAGAACTGCAGCGCTTCGT
TCGGGTCGTTGCGCTTGACACGGTGCATGCTGTGCGCGTGGCGAAGCTTCACAGGCTTCTTGCGCTCCCAGTGCCACTCCTCAGTCGGTGGGAAGATCGC
CATGGGCACCATCACGGAGCCGTTTCCGCAGATCGCGACGTACACCGAGATGTAGTCATCGATCTCCGACGGTTTCGCGCCCTCGGGGTTCTCCTTTGGC
GGCGCATCTTCGCCAGCTTCTACCGTTGGGTCCGGCTTGTGAAAATCTAATCTAGTCACAAAGTACATGAACTTTGTTGGGAACGGCTTTTGGTCAAAGA
ACTCGCGCAACTGCTCGCGCAGCGTGGTCATGTCCTTCTGGTACACCTCCTTCACCTCAGGTGTCGTGTAGTAGCCGNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNGCGCATGGGTCGCCGTCGGGTCCACCGTCGATGGGAATCCAAATGGATCTAGCACACATGAGGTACATACACCACGCACAAGTGAACACC
CAAGCATTTTGCATCCAGAAGAAGAAACAAACAAAACAAAAAAATGTCGAGTATGACGTACTGATGCCGTCGCGGCCGACGTCCTTCTGCGTGATGCGCA
GCGCGTGCTTGACCTCGTCGAAGCTCGTGTGGTTGGAGCAGAACTTGTTGTAGCCGACCCAGTACTGCGCGTACGTCTCGTTGAACACGAGATGGCCGCG
CTGGATCGTGGACGCGCACACGAGGCGGTTCGGATCCGTGGCGCGCAGGCGGTCGATGTTCTTCTTCCAGTCGCGGATCTGGCCGGTTTTGACGCCGTAC
TTCTGCGCCGTCACGGCGATGAGCCCCGTGCGGTCGGCCTCCTCGATGATCTCGAGCTTCTTGCCGACCGTGAGCCCACGGTCCGCCTTGCCGCGCGCCA
TGTTATCAGATGCGCGTTGATTAGATTAGGCAGAGGCCACTGTAGCTCTCGCTTCTTCGATGCACTTGGTAGTGTGGCGCGGCAACGCGCGAAGTACTGT
GAGCGGCTCCAGCGAGTTCTCGTATAATGGCCCC