Description :
From Genome Similarity Track
Location :
Scaffold_2058:769- 1948
Sequence
1179 bases(100 bases per row)
AGGTCGCTTGGATCCACCTCACTGTAATGGTACACTCGCCGTGGATCCGAGCTCTCCAATCATCCAACATCATCTCGCAACCGTCTGTGATCTCCGTTGT
CCCACGAAAGTTCGAGATCCATTGTATCCCTCATCCCTATACCCTGGATCCAGGTCCCTCCAGGCGGGATCCTCCCTCCTTGGATACGAACTCAGAAGTA
TGGGATCCGGGGTACCTCGCGGTGGATTTTGACTCCTCATTAGCCGTGGCTACTAGATCCACCGTCAGAGGGCACCGACCATCCTTCCTTCATAGGATCC
ACACTCGATCCACTCTTGTATAGTATATCCCATATCCATCTTAGCGAATCCAGGTAAGGGTGGATCCGAGGTAAGTCTTGGTGGATCTTGCCTTCTCGTA
CGTCGCTCATATCAGATCCATCGTCATTCCATACGGGGTGCTGCTCGCCATGGCTAATTCACCACAGGCAACTTGCACCCGTGCCAAACAACCCAAATCC
TCTATAATCACTTGAAATTGTCACTGATTCGGGATAGTGACCCCGCGTCAGGACCATTCTCTTATTTCTGAGAAAGCACTTCACCACACGACTTTTCTCC
GGTGATGGACTTAACTCTGGCAAAGAGGTCCCGCGTCGCGGATACTATGAGATCCAGGTCTAGCTCGAAGATATCCTCTGCGTCGAACACACCAGCTACG
ATGCCTGACTCCGTAAGCAAACGTAATAGATCTTTGACTGCCACCAACTTGTTCGCCGTTTTCGTTGGTGCTCTCACCGGTTCCCTTGGATCTTCGATCT
GTCGTGGATTCAGGATCTGCATGACAGGATCTTGATGCAGGAAGTCGCGTAAAGCTTGGTGGCGATACACAAACTCGAGATCCTTGTCGGACCAGCTTGA
CCTGGATCCAGCTTGGTCTTCTTCCGACTCTGGAGCTTGCATCTTCTTCCGCGTAGTCTTACTCGTTTTCGTCTTCTTTCTTGTTTCTTCGACTAGCGGG
CTTGGGTTTAGGTACGGTGTTGGCTTAATCGGTGAATCTGCAAATGCATACCGTTTCGCCTTCACTTTCCCTTGTTTTGTTAGCGGATCTTGACTTGCGT
CAAGATCCGCAGGGGTCCCCGAGGGGACCTGGGGAGGATAGAGAGGTTTCTCTTCTAGATCCGGATCCGGATCCACCTC