Description :
From Genome Similarity Track
Location :
contig_13:768931- 771374
Transcript NameFunction/comments
g2962.t1ETI36068.1 hypothetical protein F443_17748 [Phytophthora parasitica P1569
g2963.t1hypothetical protein

Sequence
2443 bases(100 bases per row)
ATGCTGCAGCGGGTGTTGGCTCAGGAGAAAGTGGACGAGCGTCAGCGGGCGCTGTTTTGCGCTAGCGGTGTCATCACGCAGCGCCACTTGCTGCAGCGCC
CTCTGTGGGATGTCGCCCATGCTGTGGACTTGTCGGTTCGAGAGACGGAGGTCTGGTTACCAAGTAATTCGCCACTTCGTGAATGTATCATTCTCACGGA
TTGCGACTTTTACTTGTGCAGGAATTGATCGCAAAACTTTCGATTCGACTGGCACCAGCATGGCGTTCGGTAGCGTCAAGTCCCAATTTCAACTGCAAAA
CAAATGATACTGCAACGGTTTGCCGCTAACCAACTCTGGGTCAGGCCTTCGACCTCTTTCTGGAAAGTGCCAACCACCCGATGTTCCTGCGGACAGGACT
GACGAGCATCGACCAGGCTCTGAATGGGGGACTCCACTGTCGAGCCCTGTCGGAGGTGCAAAGCTACAGTTGTAGATTGAGGTGGATGTACTTGTAGCTG
ACGAGATGCTGTTGTGAATAGTTTGTGGGCACGGCTGGAATCGGCAAGAGTCAAGTCGCTATGACACTTGCAGTGATGTGCGCAATGGACTAGCCAGACA
ACAGCGTCATGTTTTTCGACGTTGAACACAACTTTAGTGCCAAACGGTTGGTTCACATGTTGCAAGACGATTCGTTGGAGCTTTTGTTGCTGCCGCTAAT
GTTTGTTGTTGATAGTTTGCTGCAAATTACCGTTGCACGGATACGACTGATAAATGCTGGAAAGGATACAGATATCAATGAGTTGGCTGCTGCTGTCATC
AAGCGTATTCGTGTTGTGAGGGTCAACTCGATAGCATCGTGTATTGCCAAGTACGATGATGAGAAAATTATTTACCGACTTGGTCCACTTAATGCTATGT
GTTTGGTGGTTGTTCACAGACTGAAGCAAATGGAGGACGCTATGTACTCGCTCAAGGTGAAGCTTCTCATTATTGACTGTGTCACCACACTCTTCCAAAG
GTGAGCCCAGCAGAGCAATCTTGAGGGGTATCTTATGTACCGGCGCTTAAATCGAATTGGAATGGTTTGATTGTCGTGCTAGCCCAACGATTTAACGCAG
GCACAGCGCCAGCATCACATGCTTCGGATGGCGAGAGACTTGAAGTGCGTAAAGCGAATCATTTCATTGCTGTTTTACTTGAGAATAATTGGTCTCTGCT
GCCGTCAGACTGTTCGCCGACACATACCAGGCATTTGTTGTCGTCACGAATCGGGCGTCCACTGTTGAAGGAGGGAGTAAGACTGCTGCATTTCTATCGG
TTGACAAGCTGGCTTTGACGTGCTTTTCTTGCATTGAAGGTGGACTCTACACAAAGCCGCTGCTTGGCGATAGTTGGGCTCACTGCGTTACCACAAGGGT
CGATGAATGCGATGGCTTTGTCATTTTTACTTCAACATCTCTGACATTTCCATGTGTGTATTACAGTTCATAATGGAGCGCCACGCCTCGCATCGTGCGA
TCACAATCGTGAAGTCATCCGTTGCAGGCTTTGTGGTTCAACCGTTTACTGTCAAGGTTCGAACTCTGTAGTAGTTTGCATAGTGCACGCGGATTTAACG
AAACATTCATTGCATGCACTGCAGGAAGGTGGCGTGGAAGCTGTCGAAGACTCGCGAGATGCAGCATCAGACGACTTTGCCATCCACGACGAGTTGTTTA
GTGATCTTGCACTCGCAGCAGTACCAGCAGTGGACCCGGCGTGTACTCTGCGCTCAACCCAGCAGAGCACCGCTGAAGACCCCGACGCAACGCAGCTGGT
CGGGCAAAGCGACGACGAATCTCCGCCACACCGAGAAAGCGCAGAGGACCAAGTGCAAGATGGCGTCGACGAGACCGAGAACAGCAGCTTCGACATTGTC
TCGGACTCCAACTCGGAAGAGGGCGATGAGTCGTTCAACTGGGACGTCACTGAAGAGTAACAGTGCAAGAAAATCACATACAAAAGCACAAACCCACAGT
TGATCAACGCCGTGTCGAAACATGGCGGGAAGCTTAGGAGGGTGTATTTAGTCCGACGCACGCCCAGCAACTGGCAGCTTACGCCTTAAGAGCGTAGCGA
CGCTTGGGGAAGTAAGACTCCTTCTTCTGCTGCTTGAGGGTCTTGAGCGACTTCTCGTGCGTGGAGAGCTGACGACGGATGGCGCGCGTCTGCTTGCGGC
GCAGGTCCAGGGGCACGTGCTTCTTGCTGCCCAGGGCGGCGCGGAGCTTGGCCTTCTGGTTCTGGTTGTACACCGTCAGCACGCGGGCGATCGACTTGCG
CACCACGCGGATCTTGCTCAGCTTGGAGGCGGCGCCGCCGATGACCTTGGCCACGCGGAGCTGGGCCAGCTCCTGCTGGTAGTCGTCCAGCTGACGGAGC
AGCTCAGTCTTGCTCTTGGTGCGGAGCTCGTGCGCCTTGATCT