Description :
From Genome Similarity Track
Location :
Scaffold_64:76892- 78858
Transcript NameFunction/comments
Physo_138491reverse transcriptase

Sequence
1966 bases(100 bases per row)
CGACGCTAGCTGCTCTTGCGCGCGTGCTCGCTCCGGGACAGCGGCATTAGGCGCTGTCTCGAGTGGGGAGTCGCGCGCACCTGTCGGTGCGTGCGTAGCG
GCAACAGGTCCATCGCTCACTGTTTCGCTGTCGCGACCGAAACGAACGAGAGTGCGCTTCTCCAAATCGATGACCGGATCATGCCGTGCAAGCCACGGCA
TGCCAATACAGGACGATAAAGGTCTCGACAAACTCTTGATCTTCATACGCGTACCATGCGCTTCTCGGTCTTCACGACGGCACCCGTTGCCAGTCGTACT
TCCAACATACTTCGAGGTATCTATAAATCCTCGAAGTCAAGCCTTGATAGACTTCGCAGTCGAACAAAGTTCTTCGACGCGCTAGAATCTATCAAAGCAC
GGAGAGAGCCGCTTGCTCTCATCGAGTTCACATTCAGGATGACAAGGTCAGGCTTGTCATCTTGGTTCTTGCAGTGAGAATGAACCTCACTGGGGGCTGC
GGTCCTCAGTGTCGCGTGTCCAAGGTCGGCACGCGGAACGGCATTACCAGTAGGGCGCCCCGCGCCTACTGGCGTCCAGTGTTTTTTGTTTGGTTGCGAC
GGTGCCCGGCACCGCCGCGATAGCCACCCTGCTGGCGCACGGGGGCCGTGCACTCCCGAGCAAAGTGACCGACTCTACCGCAACGGTAGCATCGCACATT
GTTTCTCTGCGACTGCTGGGGTCCAGCAGTTGCAGCACTCGAGAGATCCATGGGTTCTGGGCCTCCCGTCCTCACTACCGGGCGTGGCTGTGGCCTCGGC
ACGTGTGCATGCAGCTTAGCCTGCCGCAGGCTAAACTCCTCCTGCATTTCAAGAGTAATTGCAGCTTCGAGAGTACTCGGGTACTCACGGAAGAGATAGG
TCTTCACAGGCCCATCTCTCAGCCCCTTCAAAAGCATGGGCATCATGCTTGCCCTGCTGCAGGTCGAGGAACTCCGCCCTCGACCGGAACTCGTTTTGCG
GTGGCTCAAACGCTTGTCTGAGCTCTTCCTTGAAACCCTCGTACGTGCTAAAGCACGTAGGATCAGAGAGTCGGCGTCCATACGCCCAACTTCTAGCACG
TCCGCCAAGACATAACATGGCGAACTCAACCTTCGACAACGGGTTGATGATACGTCGAGCCGCAATGGCAGTGTCGAGTTCGACAAGCCAACGGAGGAGA
GGTTCACCCTCTCTTCCGACATAGTTACTCACATTGAGCTTTAGCGATTGCGCGCGTGGTGTCGTCCCGGACGACACCGTGGTAGTAGCAGCAACATCGC
GTTGCTCCTTCAGGATGAAACCCAGAGCAACGCCGTGTTGCTCTGTCGGCGTTAGCGTACGCAGCATCGTAGCAACAGCCGTCTCACCAATGACTGTTGA
CAGTCGTTGGAGAGCCTCCCACTCTGGATCCGACAGGTGGGGACAGTCAGCGCGTGCAACGTGAGTTGCACGCGTAGTGGAGCTTTCCATGGGCACCTCT
GTATCCATGGGAAGTTTCTCAGCTCCGCGTTCGTGCGGTGACGTACAAACTCAGGTAGTCGGTCGTTGGGCGGACTACAAAGTGCTACCAGGTGTAATGG
GCCTACTTTGGCCCACTACTTTAGCTTACACGTGTGCGCGTGTATGTGAGGAAGCGTAGCTTAGTTTAAATTAGAGTTAATTATACTCGGGCCTCCGAGT
ATAGATTAATCTAAATAAACGATCCAAATAATGTTTTTGGGTTAAAATGAGAACTGCTATTTTTGTTTTATGTTTCTGACTTCGTCTAAATGTAATATTC
TAAGATAGGAATCTGCCAACGGCTGGTTGGCAGAATTCCAATGCTATACATGTCGCTCATTGGCTAAGAGATGCTGCTCTCAGCCAATAGGAATCCTAAG
TCTCTATGGACCACCCGTCGTGGTGGTCGTAAATGTATGTAGCCTTTGGTGTGTCTACACCAAGGT