Description :
From Genome Similarity Track
Location :
contig_13:768890- 771333
Transcript NameFunction/comments
g3121.t1hypothetical protein
g3122.t1hypothetical protein

Sequence
2443 bases(100 bases per row)
ATGCTGCAGCGGGTGTTGGCTCGGGAGAAAGTGGACGAGCGTCGGCGGGCGCTGTTTCGCGCTAGCGGCATCATCACGCAGCGCCACTTGCTGCAGCGCC
CTCTGTGGGATGTCGCCCATGCTGTGGACTTGTCGGTTCGAGAGACGGAGGTCTGGTTACCAAGTAATTCGCCACCTCGTGAATGTATCATTCTCACGGA
TTGCGACTTTTACTTGTGCAGGAATTGATCGCAAAACTTTCGATTCGACTGGCGCCAGCATGTCGTTCGGTAGCGTCAAGTCCCAATTTCAACTGCAAAA
CAAATGATACTGCAACGGTTTGCTGCTAACCAACTCTGGGTCAGGCCTTCGACCTCTTTCTGGAAAGTGCCAACCACCCGATGTTCCTGCGGACAGGACT
GACGAGCATCGACCAGGCTCTGAATGGGGGACTCCACTGCCGAGCCCTGTCGGAGGTGCAAAGCTACAGTTGTAGATTGAGGTGGATGTACTTGTAGCTG
ACGAGATGCTGTTGTGAATAGTTTGTGGGCACGGCTGGAATCGGCAAGAGTCAAGTCGCTATGACACTTGCAGTGATGTGCGCAATGGACTACCCAGACA
ACAGCGTCATGTTTTTCGACGTTGAGCACAACTTTAGTGCCAAACGGTTGGTTCACATGTTGCAAGACGATTCGTTGGAGCTTTTGTTGCTGCCGCTAAT
GTTTGTTGTTGATAGTTTGCTGCAAATTACCGTTGCACGGATACGACTGATAAATGCTGGAAAGGATACAGATATCAATGAGTTGGCTGCTGCTGTCATC
AAGCGTATTCGTGTTGTGAGGGTCAACTCGATAGCATCGTGTATTGCCAAGTACGATGATGAGAAAATTATTTACCGACTTGGTCCACTTAATGCTATGT
GTTTGGTGGTTGTTCACAGACTGAAGCAAATGGAGGACGCTATGTACTCGCTCAAGGTGAAGCTTCTCATTATTGACTGTGTCACCACACTCTTCCAAAG
GTGAGCCCAGCAGAGCAATCTTGAGGGGTATCTTATGTACCGGCGCTTAAATCGAATTGGAATGGTTTGATTGTCGTGCTAGCCCAACGATTTAACGCAG
GCACAGCGCCAGCATCACATGCTTCGGATGGCGAGAGACTTGAAGTGCGTAAAGCGAATCATTTCATTGCTGTTTTACTTGAGAATAATTGGTCTCTGCT
GCCGTCAGACTGTTCGCCGACACATACCAGGCATTTGTTGTCGTCACGAATCGGGCGTCCACTGTTGAAGGAGGGAGTAAGACTGCTGCATTTCTATCGG
TTGACAAGCTGGCTTTGACGTGCTTTTCTTGCATTGAAGGTGGACTCTACACAAAGCCGCTGCTTGGCGATAGTTGGGCTCACTGCGTTACCACAAGGGT
CGATGAATGCGATGGCTTTGTCATTTTTACTTCAACATCTCTGACATTTCCATGTGTGTATTACAGTTCATAATGGAGCGCCACGCCTCGCATCGTGCGA
TCACAATCGTGAAGTCATCCGTTGCAGGCTTTGTGGTTCAACCGTTTACTGTCAAGGTTCGAACTCTGTAGTAGTTTGCATAGTGCACGCGGATTTAACG
AAACATTCATTGCATGCACTGCAGGAAGGTGGCGTGGAAGCTGTCGAAGACTCGCGAGATGCAGCATCAGACGACTTTGCCATCCACGACGAGTTGTTTA
GTGATCTTGCACTCGCAGCAGTACCAGCAGTGGACCCGGCGTGTACTCTGCGCTCAACCCAGCAGAGCACCGCTGAAGACCCCGACGCAACGCAGCTGGT
CGGGCAAAGCGACGACGAATCTCCGCCACACCGAGAAAGCGCAGAGGACCAAGTGCAAGATGGCGTCGACGAGACCGAGAACAGCAGCTTCGACATTGTC
TCGGACTCCAACTCGGAAGAGGGCGATGAGTCGTTCAACTGGGACGTCACTGAAGAGTAACAGTGCAAGAAAATCACATACAAAAGCACAAACCCACAGT
TGATCAACGCCGTGTCGAAACATGGCGGGAAGCTTAGGAGGGTGTATTTAGTCCGACGCACGCCCAGCAACTAGCAGCTTACGCCTTAAGAGCGTAGCGA
CGCTTGGGGAAGTAAGACTCCTTCTTCTGCTGCTTGAGGGTCTTGAGCGACTTCTCGTGCGTGGAGAGCTGACGACGGATGGCGCGCGTCTGCTTGCGGC
GCAGGTCCAGGGGCACGTGCTTCTTGCTGCCCAGGGCGGCGCGGAGCTTGGCCTTCTGGTTCTGGTTGTACACCGTCAGCACGCGGGCGATCGACTTGCG
CACCACGCGGATCTTGCTCAGCTTGGAGGCGGCGCCGCCGATGACCTTGGCCACGCGGAGCTGGGCCAGCTCCTGCTGGTAGTCGTCCAGCTGACGGAGC
AGCTCAGTCTTGCTCTTGGTGCGGAGCTCGTGCGCCTTGATCT