Description :
From Genome Similarity Track
Location :
Scaffold_2:76889- 85624
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_2-snap-gene-0.53Conserved gene of unknown function
Pytir_DAOMBR486maker-pir_contig_2-fgenesh-gene-0.19Conserved gene of unknown function
Pytir_DAOMBR486fgenesh_masked-pir_contig_2-abinit-gene-0.138Antigenic protein

Sequence
8735 bases(100 bases per row)
ACACCGTATCTCACGTGCTCGCGATGCAACAACGTCACGTTCGTCAACCTGCTCCGCGTTCGTCCGCGGGACCACGAGAAGGATGAAGCGCGCCTGAGCG
AGTACGAGCAGCTTCCCATCTGCACAGGGTGTGGGAGCACAAAGTACCTGCGCGCGGGTGTTGTGAGCTTCCAGGAGAAGATCGACGAGGAGAAGAATGC
GATCAAGGAGTTCGAGCGGAAGCGGGTGCCAGCGACCGCGCTGATCCAGCGCATCGCGCGCGGCTTTCTCAGCCGCGTCGAGTACCGCAAGAGCAAGATC
GAGCGCGAGCGGTACTTGCGCAAGATCAACCGCTCGGCGACGAGGATCCAGACGCGCGTGCGCGGCATGCAGGCGCGACGGCGCACCGTGATCGAGCGGT
GTCTGCGGTTGATTAAGACCATGCATCCGAGTGTGCTTGCGTACGCGCTCGCTGCGCGACCAGACAAGCCGCCAGTTTTTTGGTATGAGAACCCAGCGGA
GCGCAACATTCTCTTCTCGAACTACAGAGAGTTCGTGCGCCGCTCCGGTGGGAAGCCGACGCTCATCAAAGTCGAGACGAATGTGATGGAGATCGCGAGA
AGGATGCTCTTGCGCGAGTACGTGCTCGTGAGCCGCATCCAGGGGCGCTGGCGGGGCATCACGACCCGCCTGGTGTTCCGCGAGTTCAAACGGCAGAGAG
GCTGGCTGCGTGGCATCCAGCAATCGCCTGCGATCAAAGTGCAGCGCCTGTTCCGTGGTCACATGAGTCGCAAGCAATGCCGTGCGCTCAAAGTGACCAC
CCAGTACCCATCTCAGATGGAAGCGTATCGACAGTCGCGATTGGACCAGCAACGCAACGATAAACGGAAGGCGTTCCGATCCAAGCTGCTGGGGAAATAC
CGCCTTGAGTATCAGGTGGACAAGACGACGCGCATGATGGCGCTGCAAGCCACGACAGCCAGTGCTTCCACCGCAAAGAAAGCGCTGGGGAAGTCGAAGG
CTTTGCCCAATGAAGATGGTGATGAGGTCGGTCCGGAGACCCACTCGCATCTTCACCACTCGCTCAAGAGTGGGGGAGCTACAACATCTCTGAGTGTACA
ATCAGCAAAGCCCAACCAGAGAGAGAGCGATACAGATGGAATGCTCTTTATTGTCGGTGAAGACGAGCAGCAACAGCACCGAGGCACGAGAAACCGCAAT
GCAAACAGCCAACGCTTCGCGGAAATTAAGCGGAAGCTCGAGGTGAAAAAGAGGCACCGAATGCGAGACCCTCGACTGCACATTCTGAAGGCGGAGCTCT
ATGCAATGACGAGTCTAGAGAGTCCACCGAAGCAGAAAGACTTGCAGTGAGGCTGATGAGAGGGCAAAGACAACACCTTCTTGCATAATGATGAAAATTG
GTCAGTGTTGCAGTAACGTAAAGCTGGAGTGACGGCACAGTAAAGTATACGCGCCGCAACAAATTGAGCAATTGAGTTGTGACGACGCATTGACAAGTGA
TGTTGAAGTTGACTTTTTGTCCGTTTGTGTGAGCCGTTAGTTTAGGACAGGCTGTCGTTGAATACGTTTTTTTGGTCGAACATAACAGAATGTATGTATA
GGTGATGTTCGAAACGTTTTAGGACAACCACCTGTTTTGACATTTTAATGCTTTATTTAGTAGATTATGTGGGATTTAGCGCTAGGTCAAATTCCCTTTT
CTTGAGCTGACAGTGAATGCGAATTTTGGTCGAGTATCTCATGGCAGGGATGGCATCGCGCATTCACTTTCCGTTCCATTCATCAACTTGCTGCGCACAG
AGCAAGCAGCAGCAGCACTCCACGGGCTGACAGACAGACAGACAGACACCAACACATCCGAGATGACGAATGAACTCCAGAGCAGCGACTGCGCGATCGT
AGCGTTCGGCTGCAACGACGACGGGCAGCTGGGCCGCGGCGAGAAGCGCCGCATGACCGGCCCGATTGACGACATCTCTGCTGTGCATTTTCCCGAACAG
ATTGAGGAACTCTTCGGAGTGGACGTCACCGCGGTGTCCTGTGGATCGCGCCACACCATGGCGCTCACCACCAATGGCGAGGTGTATTCGTGGGGCTGGG
GATCGGTACGTTTTGCTGTATATATGTGCTGAGTTATGCTACTTGCCATTCGTTCATCGCACCCGCTTACTGGCGCGTATCTGTCCGTCATGTGCTTGTT
GTTGTTGTTGTTTTTCTGTCTTTTAGATGGGACAGCTCGGTCATGGCGACTTGAAGAGCTCGAACGTGCCGAGAAAGATCAAGTTCTTTGCGGAGCATGG
ACTCGTGGTCGACTACATCTCGTGCGGAGGCTGCCACTCGGCAGCTGTGACCAAAGATGGTGAGTGCAGGCATGTCTTGTTGGCTTGTTGACAGACGCTC
TGATAGTCCTATGATGCTAACGAGCGAGTGCCATGCCTCCCTTTTGTTGTTTTCGCAATAGGCACGCTGTACATGTGGGGAGAGGCGCACTGGGGACAGC
TCGGCTTGCCAAAGGAGTTCCGCGATCTGCACCAGTCATTGCCGGCGAAGTGCCCCGTCTTGCAAGACGGCAGTGAGGAGAAGATCGTCAAGATCAGCTG
CGGTGCGTATTGATCTACAGCGTGCAATTAGTTGCGTTGGCACATGAGCGCATGTGATTCATTGTAATTCTCATCCTGTGGATCTGTTGCGATTTGGATA
GGTGGCGCGCACACTGCTGCTTTGACCGATAAGGGCCACGTGTACATGTGGGGGCGCTGCGACAATGGCCAGCTCGGTATCGGTCACGAATGGTTGCGCG
ACTCTGACGACGACGGAATGCTCGGAGTCAGTCGCCCACACCGCGTTGAAGGGTTTAGCGACGAGAAAGTGGTCCAAGTCGCGTGCGGCGCGTTCCACTC
GGCGGCTGTGACGGAGTCTGGGAGCGTGTACATCTGGGGTAAGGAGGACTACGGCATGCTCGGCGTCGGCCAAACCTCGGATGTGCAGATCCCAAGACGC
ATTGAGCTGTTCGACAAGATCCCCGCACTGTACGTTAACTGATATGATTCATGCTGCATACTGGTATGTTGAATTGCTATTGATCACATGCGTACTAACC
AAACGGCTATGTGTGTTTGCGTTTTGATTGTCAACAGGCGTGTTTCTTGCGGCGGGTGGCACACGGTTGTTGTGGCCAAGTCTGGCGCGTGCTACGCGTT
CGGACGTGGCGAATACGGACGTCTTGGGCTCGGAGACACCAGAAGTCGCTACAGACCACACCAGGTTCGCTGCGTGTCAACTCGCTTTGCTTTACTTCTT
GTTGCCACCATCACTTAAACTCGAACTGGAGTCCAACCTCTGTTTATCATGAAATTGCCTATTTACTGGGCAGGTGGAAGCGTTGAAGAACAAGATTGTG
GTTCAGGCAGCGTGTGGCGGCTCGCACACTCTTTTCCTCACAAAAGATGGTGTCGCCTACAGCTCCGGGCGAGCAGAGTGAGTCGATTATGCATCATTCC
CACTTTGTTTCTTTCATTTTCTAACTAACCTCATCTTCTCTGTTATGCATATCAACTATGTAGCCACGGTCGCCTTGGAGATGAGAATCTCAAGACGAGC
ATCATCCCAAAGCCGCTCAATCTAGGAGAGCCGTTGGTGCGCCAAGTGTCTGCTGGAGGTGCGCACTCGGTCGCGCTGATGCACTCGTCTCGCGCGCTGC
TCTCGCCCCTGCTCACGTCGCTCCCAAGCATTCTCGAGGTCCCTCAGTACTCGCTCTGAGAAGGCAAATGGTCGCTGGTGTCATGTTTCGACTTGCAAGT
CGAGCTCAGATTTCCTTCAGTCAGTATTAATGTTGAAAGGTTTTCACGTGCCAACAGTCTCTTCATTTGACAGGGTATAATGTATCAGCGTCAAGTGTAA
TAAATATCCACCTGTTTTCCAAAACATGTATTTCATAAACATTGAGATGTTGTTTATACTGGTTGATTGCCTTTATATCATGCATATTGCTTCTGTAAAA
ATGAAATCCATTACAGGAGGCTTGCTGCAGAGTGCTGATCACTCACTCCTTGTGACTGATACAGTGCGCGCAGTGCGACTTCACACACACAGTCAAGCAA
GGTTCTCTAGCGACAATGGGCGCCGCCGCCGCAGCAGCGGACGTTGACAGCAACATGAGCGACGAGCTCACGACGTACCGCTCGCAGAATGGCGACATGC
GACTGCGCAACCGTCACAGTGGAGGTGGCTCACTGGCTGATAACACCAGCAGCGTGAACGGTGGCGATATCGTCACCACGACCCACACGATCAGCGAGAT
GCGCGTGCACGAGCGAAGCCAGCGCGGGCGGCAAAGCGAGAAGCATGTCGTCGTGAAGATGGCGGTGCGACATAAATCTCATCGACATGGTGGTGGAGAC
GGCTCGGATGATGGTGGCGGTGGTGCCGAGCGAGACATGAATGGGACCAACAGAAACGACGGGCAGTACAACAACCACAATGGGAGCCGCGCCATCACGG
TGGAAGAGATTGACGGCGACGATGGCGAGGAAGACAAAACCACACGTGGCAGGGACGCCAGTGACCACTCTGACACGATGAATAACAGCGGCAGCATGGC
CAACAACAGCAATGGCAACTTGCAGCTCACAGATGTGACTGACGCGACGATCCAAGAGACCATGCTCCAGTTGGTGACAGAGACAGAGCACATGAAGCAG
TACTTCCATGGCCAGGAGCAGGCGTTCCGGAGAGAAAGCGAGTACATCGAGCAGCTCAAGCAAGAGCACAAGGCGCTGAAGACCATGGCGAAGGAGTACA
AGTGTCGCGCGCGCGAGCAGAAGCGCGTGCAGCGGATACTGCGCGAGGTAAAGAAAAAAGACAGCCAGTCGCACTCGCGCGGCAACAAGCGCAAGGTGAA
GAAGCAGTGTCAGCGGCTTCAGCAGTACCAGAGCGAGCTAGCGCTGCGGCTCGAGCTCGTGCAGTCCAAGAACAACGTCTACGAGATGCACGTTGAGAAG
CAGCTGGCGGAGCTGCGCCGCGAGTACTCGGACAGCTATTTATTCCCCAATCCGTTCCAGTAGGGAAGGCTTCGCCACAGAGAGTCTCCATTATCATCGT
AGCTCATAGTAGCAGTCAAGGTGTGATCGAGTACACACCGCCATTTTGTGTGTGAGTTTCTTTTTGAATTTGGTTTGACAATGCAAATTGCCAATGCTGG
CTGGTTGTTGTGTTTAAAATATTATAGCCAATCATCAACCGCTATTTATATTTACAGCCAATCACAGATTTTCCCTCGCAATAAGTCGTGCGAATTTTCT
CACACAACAACAACAATGCGGCAAAACAAACCCACACACAAAAGAAAGCACTTCCAGCGCAGCAAGACAAACGAGACCGCGCCGCCGTTGGTCTCTGCGT
CGGCATCCCCGCAATGATCTGGCCCGACAAAGAGCACGATTCGTCGCGGCAGCTGCAGAAGAAGCTCGAGTACGCCAAGGAGCTGGAGTTGCAGATCGAG
CTGCGGCGCGCGCGCCAGCGGGAAGAGCAGCTGGAGCTCGAGGAGCTTGAGCGCAAGTTCCAGCCGGACGACCGCTCACCCGCCAAGTGGCTCATCGACG
GCGGGTACTCGGCGCCAGTGGTGCAGCACCCAGACTTTGCCAGCTACCGCTCACCCTTCCGATTTCCACAACAGCAGCACGAGGATGCGGCGAGTGATGG
ACAACAGTACAATGGACGAGCCGACTCTGCACCATCGCCATTGCCGCCTTCTGCGGGCGAGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGCCGAGT
GTGGGCAGAGACGGCAGCACAGCGAATGGTCACACGCGCTTCCGCATAACGGACTTGCAGGACCAGACCGATCGACTGCGTGAGCGCGCGCAACAGCTGG
AGTGGAAACGGATTCTGGACGAACAGGTGCGCGAAAATGCGCGGCTCAAGCAGCAGGAAGAGGAAGAGCGACGGCGCGACGAGGCAGGCTCAGTGCGCGA
AGAGATGATGTTTCTAAGGGATCAGCAGCTGGCTGCGCAGAGAAGAATGGGCTTCCCAGTGGATAGTGCGTTCCAGCAAAGCCCGGCGTACACTCCATCT
GCTCCAGCAGCATCTCCATCACAGGCTCAATACGAGCGATTGGACACACCACCAGACCATCATCATCAGGTGTCGGATTATCGACAGAACCATTACGAGC
GTGTAAGGGAGAATGACAACTTGTACGGACTCAGTGAACCACAGCGAGCCAACCAATTCAATTATCGTCACCACTATGACGCAGACACCAACACGATGCC
GCCGCCAGCTCCATCACGGTTCAACTTCCCATCAAGCTCTCCACAGTCGAATCGCGAACCAGCTAATTTGCAGACACAACAGCAGCAGCAGCAACAACAA
GAACAACAATCCTACGACTCGTTTGCAGATTCCAGAAGCCTCATCATTAATGAATATCGATCGCTATTGGCGGACATTCGACGTGAGCGCGAGGAGCTCC
GCCAGGAGAAAGAAGAGCTTCGACAAGAGAAGGAGCAGTTGCGGCTTGAGCGCGCGCTTTTGCAACTGGAGAACGAGAAAATGGCAAATTTCGTTGAAAC
GCAGAGACGTTTGAATGAGCAGCAGCTGGAGATGCAGCAGGAGGTCTCCTTTCGTCAGCAGCCGCAGCAGCAGCAGTACCAACAGCAGAGTGTGAGTACG
TTTCCGAGTCCTATGCGCGAGTACTACCACGCGCCGCCATCGTCTGCCCATCGTCCTCAGAGACCCCCTGCTTTCGACCTTTCGCAGATCAATCAGATGG
AGCGATCGATCGCTGCGCTCGATATGGGTAGTCGCAGTGTGAAAGAGACTCGCGCGCCAGAGCGCAGACCAAGTCCGATCTCGATGGACGACTTTGCTGT
CCCTCAGAATCGACTGGCGCCGAATGTCGACTCGCCTCGATTCAAGCGGCTGTCCCAGTTCCGGTTCAAGCCAACTGCAGCGGATGATAGAGAGTTGAAT
GCACTGGACCAATCTCTCATCGGCGAGTCGGTGTTTGTTGCTCTCAGTCCCGAGGAAGTCTCGAGTGCCGCATCGAGAGGCCCTCCGCGTATAACAGAGA
CAGCGTCTCCTCGGCGGGGAGAGAAACCTGAGAACAGCGTTCGCAATGAACTGCGCAGCAGCCGCGTGATCAAGAGTCGCGGCTTTTACAACATTGAAAG
TGAAGCTGGCGCGTTCCCTGCACGCGCTGCTGAAAAAGAAGCGGAGAGACACAAGTCCGAGAGGCAACATCCCGAGAGAGAGAAGAGAAAGAAGAATTCT
GCGCACAAGTCGCCAAGCCGAATGCCTCGCAGCGCGGAAAAAGCTCGACTTCAACAAGAGAAGCCTGCTGCGAAGGTGTTCAAGGAATACGAGACGAGTA
GTAAGTTCGTGCCATTCACGCCGTCATCATCCGCGGCTGATGTTCAACAGCAACAAAGACAGCAGCAGAGCAAACTCAGACAGCAACAACGTCAGCGGCA
GTTCGCCTCGTCGGTGGGTCACAACGGCAGTGCAGCTGCTGCTGCGAACTACAATGACTCGGAGGATAGTGAGGAATCTGAGCTATCGAGGAGCTTGTTC
CAAGTGAAAGTGCTGGTGTAGGCTGACGATGTGATGCGTGCGTAGAATGGATAGATGAATGGGACAGTGATTGAGTGTACTATGTCAATGGATCGGGCTT
GCAGCTTTTCGTTCTCACACGTCACACTTATATTTTGATGATCATATTATGAGGTGGTACACACCACCTCACGGTTGTACGCGTTGTGATTGGTTGAATA
TCGGCCAGCCAACCAAAATAGTATTTGCTGCTTCAGCACTTTCCAAAGGCGTCAGACGCAGATAAAAGGCAAGAGAATGGCGTCGTTCCAGTTCCCCATC
GCGACGGGCAAGAAGAAGCCCGTGAAGGTGTTTGAGTGCCCCACGGAGACGTGGAAGGAGCGCGCACCGAGAAGCGCCAAGGTGGGTACGCTGCTACGGC
ATCTAGAGTTGTGTTAACACGATCGCTTTGCTTGTACCTCTCGATTGCTTCGCTTTGAGTAGCACAATGTTCTCATGTTTTTTGCTTGATGCTACTGGTG
TTGCGACTGATAGAAAAGCGACAAAGATGCTGAGCCAGAGCTTTCGCTGAAGCAACAGATCCGACAGGAGTTCGACGAGACGTTCGAGTCGGTGAAGGAT
TTTGGTACGTCGCCGTCTGTGCATTGTTGCTTACTTGGGCTGGGCTGTTGATGAATGAAAGACAGGGATACGCTTATGGTGGATAGATGCTAACAGAGAG
TCCATGGCATTGCGGTTTCTTGTCCGACTGTTCCAGCGAATGCGAGTCTAAAGGGTAAAGAGAAGAAGGCGTTCGAAGCCAAGAAGATCGAGACGCTCGG
AGGCAAAGCAGCGAAGACCCGCACGATGCCGTACAACATCCTCATGGGCCTCAAGAAGAAGGGAGCTATTCGCGAAAAGAAGCAGCAGGAGATGGTACGT
GGAGCCAGCGTGTTGCTTTTTATCTTGCCTGTGAAGCTGTGTCGACGGTATGTCCTTCAAGCCACTGACTCAACGAATTCTTTTATGGTTACATCAATGA
TCAGAACAAGGATGCAGACGTTGTGTCGGGCAAGCGGAAGGCGAGCAGCAAGTCGAACAGCAGCAAGAAGAAGAAGAAGATCGACTACGGGCTGCAGGTC
ACGAAGGGAAAATTCAAAAACGGCATCTTGACTGT