Description :
From Genome Similarity Track
Location :
Scaffold_387:7686- 9053
Transcript NameFunction/comments
Phyke_g9085hypothetical protein PHYSODRAFT_340450

Sequence
1367 bases(100 bases per row)
GGACGGCGAACATATGACCGTCAAACCTTACGGACCGGCGGTGACTCTGGCCATGGCCCTCAACTATGTGATCGGCACAGGCTGCTTCGGTCTCCCGTAC
GCCTTCATGGAGGCTGGCATTGGTCTCAGTCTCACCCTTATGGTGCTCGGAGTCCTCGGTTCCCTCATTACAATGAACTACACGCTCGAGTCATTGGCTC
GTGCTGAAGGAGTATGTGCAGCTACGGGAGGGGGCGTGCCTCGTCACCAAATCACCTACCGCAAGTTCGAGTTCGCCACTATTGCGGAGATGTTTGTGGG
AAGATGGGGCAAGGCAGCGGTGCAATTGGTCATGGGCTCCTACTGCATTGGCTCCTTGTGGTCCTACGCGTCCGtgttctcgtcgtccacggCCTCGCTC
TTCTACTCGTACGTGCTCGGGGAGTCCTGTGATGTGTACGGCGACTCGCCGTCGAGCGGCTGTCTGGACGGCTACTATGTGTTCATGGCCATCTTCTCTG
CCATTGTGTTGACGATGGTGCTCATGGACATCAGTGACCAGGCGCTGGTGCAGAAGTTCCTGTCCGTGTATCGTATCGTAGCATTTGCGCTCATGTTGAT
TACGATGACGGTGAAAGTGATGAGTGACGGCAATGACTTGGTCACTTCTCGCTACGTTTCAATTGGTCTGGTGAACTGGGAGAACTTTGGCAAGGGCTTT
GGACCGACTCTACTTGCACTCAACTGTCAGTACAACATGCCGGACGCTCTGCAGCCTCTGAACCCCAAGTCTAAAGCACGTTTCGTGACGTTTGCAGCGT
TGCTGATTGCTGGCACTTGCTACCTGCTGGTCGGTCTGCTGGGTGTACTCGCTTTTGACAAGATCAACCCGCTTGCAACGCTCATGTGGAGCTCGTACTC
TGGCTGTGGTAACGGATGGGAGGAGTGTGAAGGTTCGAATCCGGTGGGGGTCTTTGTGCAACTTGTGATCCTGCTCTTCCCCGTAGTCAACGTGGTGTCA
GCCTACCCGATGGTGGGAGTCACCGTGGGCGACAACATGTTCATGTCGTTCCCATCGCACCTCACTACGCGTTTTGGCGAGGGCGTCACGCGCAGCATGT
GCCGACTGTCGGTGGCTGTGCCACCCATTCTGTTCGCCATCGTGTTCAAGCGTTTGGATTTTATCTTTGCTGTGGCAGGACTCTTTGGCTTCCTCTTGGG
ATTAACGATCCCGTGCTGGTTCCAAGTCATCGGCAGTTGCTACTGTCGGAGAGTATGGGGTTTCCCCGGTGCAGCTATCACCGAGTTCACGGAGCCGATC
GTGAGTTCTGTACCGTTCGCCAGCATCTTCCTGGCGCTcaccttcgtcatcactgctgttgccatcg