Description :
From Genome Similarity Track
Location :
Scaffold_424:7685- 9973
Transcript NameFunction/comments
Phymu_g9766conserved hypothetical protein

Sequence
2288 bases(100 bases per row)
TTTCGTGACTTTTCGCCACACGATGGAGGCTCCAATGGACGAGGCCGCCATGGAGCAGTACGCCGATGTACGTTGTCCGTTGCCGGTGCTTGACATAGAG
CTGTTGATTCTGCGCAGGACGAAGGTTTAATGCACTCTCACCGCCTTGTGGTTGTTGCGCAGTGGCTGGACAATTTGGAGAAGACGGACCCGGAAGGCTA
CAAGCAGTTTATTGCAACGATGCAAAGCCAGCTACAGGCTGCAGGACTGGGGACCGACGGTCCTACTGGCGCGCCACAAGGAGATGCCGATGTAGCACTA
TTCGACATGCTCAAGAGCTCAGCTGGTGCTCGGGGAGCTTTGGATTCGAATTCGCCAGGTTTGATACGCAGATCGAAGGAAACTGCAGTATCTGGCGTCT
AACTTGAACTGTGGCTAGACTTCAAGCCAAAGTTTCCTGGGGACAAAgtcatggaggaggacggGTTGAAAGCTAAGCCGGAGGGGGTACGGTGATGCTA
ACTTGCTCGGATTAAAGTGAGACTGTTAATAATAATTAGTGTGCCTCGGGATATACGGCAGATGCATATTAATGTGACACCAGGTTTTGTGATGAAGACA
ACGGAAatcaagagcaagaagaaggcacgATAGTCCTTatttattgttttttttgtggGGATACCTAATTGACGTTTGATATCGCAGGTATTCGTGAACG
TAGTATTTGCTGATGAAATTCAAGAATtttcggagaagaagaagctggatgacgagggaaaagagcaagaagtaAGGTATCACCTAACTGTGCTGTGAAG
ATTCAGGCTCAACTGACGTGGAATGACTTGTGTGCCTAGGGAATTCACGTACCACTAAGTCTGGGAGCGCCTCATGAagtcaaggacaagaagggcGATA
GTTCGCTGGCTTTTGATGTAGCCGTGAACACTAAAGTTGTAGAAGACTGTCAATCAGACAAAACTGGCGCTTTTCGCAACTTTGTGTGCGAATTGGCAAT
CGAGTACATCGATCAGAAGGTAAGAGAAGTCTTGTCTTGGGTACGATCAGGAGAGACTTTGATGATTTTATTGATGCAGTACAAAATCAAACTGGATGGT
CGCTATAAACTACCGCGGCTGACATACCGAGGAGAGCTACCTCCGCCAAAGCACTACATCCGTAAAGCTCAGGCACCAATCATCCAAGAGGTTACTTCGA
AGACGGCGGGTAGAGCAAAACCCAGAGCGAAGAAAGCGACCAAGACTTTACGTGCTCCAAAGACAGCTACAGCACGTTACGAGGTTGTCGAAGAGAAGAG
TGGCAAGCAAGCAGTCTGTTCAAGACTCCCTTCCGTTATGAAGGATAGCACGCCACTATCACCCGAGATACTAGAGCAAGCGGGAGATAGGTTGGTCGTC
TCCGTTCAGTTGGCTAATAAGGTGGAGAGAACTGACATCGCGTTGGAGTTGCGAGCCGAGTTGTTGAGTGTAAAAGCTGCAACGCATCATGATTTGGGTA
AGTTCGATGCTTTTGTAGTGTATGTGGAAACGTATTTCTTACATCATCTGGCTGTTCTACATAGAGATCTTTCTTCCATATCCTGTAGAGGTTAACACCG
CAAGAGTCCGCCTGAACCAAGGCAGCAACACACTTGAGATATCAGTTACAATTGATAAATTCTGGGATAATGCCGGACCAGACTGCGGATCGGCACCGTG
GCTTCTCGCccaggcgctggacgacgaaaTTGAGTCAAGCAACAAAGAGGGATCGACGCccatcaaggagaagccTAAGTCATTAGTGGAGATGTTCCAT
CTTGCCGATGCAGCAGAGTCAAGTGGCGAACTGTATGGAAGTGGAACTGCACAGAAGACCACACGGTGGGATCCTGtactggacgatgaagagctgcccG
AGGATCGATTCCACCGCAAAGATATGATGTCTATGCACATTTTGGAGCAGCGACGAATTGAACGAGAGCAAAAGGCaaaagaagctgaagagaaACGCAA
GGTGAGACGTACTGAGGTCGAGGgcatgcagaagaaggcgaaagaGGCCGGCAAGACGTGGCGTGAAATGTATCCGAATGAGCCAGAAACGACCTACATC
GACATGGAAGACATTGTTCGGCAGGAAAAAGAAAGACTCGACCGTCACCAGGAGAAGCaaggcgaagacgaagacccAGCAAAAGAATGCATGCCCACAG
AGGATGCACTGCGCGCTGCAGCGAAATGGGCCGAGAACAAGAACGGCAACCTCGATTTGCAATCCGCATTGGCATTTGATCTTCTCTA