Description :
From Genome Similarity Track
Location :
Scaffold_8:7683- 12166
Sequence
4483 bases(100 bases per row)
GGTAAATCGCTCGCATTATTTCAGGGAAGGCCCTAGTGTCGGCCCTTAACATGATCCCGATGGGGATAGGTTGGATACTCCCCCTTTTAGAATGGGACGA
TGCCGTGGCAGTTCACTGGAGGTTGTTCATGCGCTGAGCCGCTGGTGATACTAGACTTGAGGGATGCCACGGATTCTTTGTAGAACCGAGTGTATTACTT
GAAGGTCTCGGACGCACATCGACCGTGAAACTGAATTGTCAGGGTGTCGATACCTGCTCGACACCTGTGCGTAGCCCCTCCCGTTGAGACctagagagag
agagagctaTATACTATTGAATTGATGCCACAACTCGCCGCGGTGTGCGGGATTGCGCCGGAGACTCTCGTGGATGACAGGCATTTTGGGGTGCCGTGTT
TGTTCAAGtacactgctgctggagtgtTGTGTGGGCACTGACTACCTAACCTTCAGCAAGCATAATGCCCCAAAGACTAGAAACACGAAGTGGTGGCCGG
ATCGGTTAAATGAGCGCAGCATCTGATAACCGCATTGATTCGTTTTTGAGAAACGGGTACTGCCGTTGCAGCATTTGGGTTGACGTCCCGAGATGGAAAA
TGGCAATGTCTTCGGTCTTTAGGACAAACCGTGCAAATGTTCTCCTTCCAAGTGAGGCGAACTCTTGGCGTCAAAGaaaggtggaggagaagaagaaggc
tagACACAGAATCCCCAGAGAGCTTGGTTAAAAGGCTCCTCTATGTTGagcgacgagaagcagaGCTCGAGCTGGTGGATAGAAACGGGCACCTTTGTGT
TGGACGGGGTTGTCGAGGCGACCGATGTCTTCAAGAGCATGCGCATGTATGGATGACTGCACGGAaagtccaccaccaccacaaaaTGGCGAATCCCAGA
CACTGTGGCCGAGATGGTCATACTGCGGACTGGGTGACCTGACCCACAGCCTTAACGGAATCCCAGCAAAACGAAATCGGCGATTTGCTGGATGCTGTCG
ATTAGCGGTAGGTACGAAAGCATCGGAGGGATGCCGAAGCGACGCCACCAATCGAACCACGCACAAAGACTCGATACATTGGTCGTATGTTGTTACCGTG
TTAGCATGCGCGCGGAGATGGAGCGCCAGATCTTGCCCCAGTCGGTTGAGGGGATGCTGCGTCTAACCACCTGCCAAGGCAGTAAACAAGCTACTGCGGG
TTGAACTGTTAGAGCTGTGTGAACCAGCATCCGCTATTGCATTATCCACCTCGGTAACGTGCAATGACGATAAACGAAGCTCCCACTCGGTTTCTCACAA
ACGCAGAAGGCAGATAACCGTCTGAGGCCAACGATTGCGGGATTCCACTTTGTTTTACCAGCTTACATCCGACGTGTTGTCGTCACGAAAGTGAACGTAA
AACGGGTGGGTGATGTTGCTACTGCAACGACGCGCGGATCAAAATGCGGCCAGTACGAGCTGCAAATGCACACGATACGGTAGTTGACGTCGAACCCAAT
GcctgttttttttttcttggacTGGTGAATAAATTACTGCTCTCTAGCGCGGAACGTCTAGGCAACGACGACCGGAGCGAGAAGAGAGAGGAACGAGGGG
CATAGGCGAGTACGACTGACGGAAGGCACTCGTTAAGCTATTTGGCGTCGCCATGATAACTTTATATAAGTCGATCGTAGATCAGCGCGAACTTGTCAGC
ACGAATAAGACCGCACAACTCGGTGTCAGATGCGTTTATTTTGACGATGACATTTCCTGAGGGAAGCGTGTTGAATTACGCTATGGGCACGCCGTTCAAA
GGGACCGCACGCAAAATAGGTGCACCCGAACATGTCCTCGCGTATATCGCCTGTGGTTAGGATGGTTTGCCATTGGTGGAAGTagagttgttgctgtcgc
aaTCGTTACAGGGATGAACACGCTTGACGGGCGCATGTCCCTAAGTGGCGGCGTCAACCGATCTCAATGAACGGTATTCAATGCGACGCAGTGTGATTGA
CTGGAGTGTGGCGGTCACGATACGCTCAACTTTATCTACTTTAGAAGATGGCATGGACGCACTTTCTGTCGAAGAGTTGAGCACGAGCACTTTCTACCGG
ATGTACCAGTCCGAGATCTGTCTTCGTTGATGGCAGCCGGTCCGAGGACTGCAAGATGGGCGTACCGCAGGGATTCCTCCATTTCTTGGTAGTTGAAGCT
CACGTCGGCCGCGACGTTGATGTGGCCATCGACCAAATGGTAATTGGAGAAGCCGTGTGGACTAAACTCGCTTGTGGTGTGGCCGTGGATGAACGTAATC
GCACCACCCACTGCACCGTAGGTCCCTGGCGAACCGGACCAATCAAATGCTGCTGACCTTTCAATTACAAATGCGTTGTCACGGTGTAGCCGACCGCCGA
CAGATATAGGTAATGGTTATAGATGTAAACGTGCCGGTTGGCGAATGCGACGTCACCGGCTTGCTCCTTAACATCGCCCACGGGATGATGATACTGTTGT
AGCACAAtcttggtggcgatggcgttTCAGTGCTCATATGTGAGCAGACAAAcaccgtcttggtcggtGAAaacgaccaagacgctgtTTCGTTTAGTGA
GGGCATGATAAGTCGGGAATGACTCGACCTGTGATTTGTGGACCCACGTTGTTCATGTCGACTACACCAAACGGGCTGATGTGCACTTCAGGCCACCGAT
CTAAACTGTCCGCGTCAAAGGCGATGCATCTCCGTGCAGCTTGCTCCTTACGAATGTTTTGATGAGGACCGTATATCTCTTGTCCACTGACTTGTGGTTT
GGCGGACGTGTAGTTTGTTGCCGAAACCGTTAGAGAGAGGCACGCGTGCTCTTGAGTGCACAATGTCGAGAAGACACAGTAAGTGTTCGTAGCCTTGACA
AGTAGAGTTCGACACGGACCGGGCCATATTTTTGTTGGGCTTGTAATCGGCTCTGGTTTGTCCACGAATAAGCTCTGTGAAAGCTGGTAGCATGGTCTGC
GTGCATCTGACGGATAAGGATAGAACGGCTTGAagagcccccccccccccccccccccccccggtAGAGATCAATACTCGGTGGGTTTGGAAGCGTGAGA
CTAAATTTATTGAGGGCACGGTTGATATGGCGAAGGCGCATTGATTCCCACATTACTGTGCGTTGAGCGCCAGAGGTGACGTACTGCGCGCTGCGTTATA
GTGACAGAGGGAACTGGCCGGAGCCAGACCTGTGGTCGTTGGgacgcggtggtggcggGCTCGCGGTACGTGCATTGCCGCGGCGAGATCGAGGCCGCGG
GAAACAGGTTCCAAGCGCCATATGGGCCAATCTATGCGCGGAGACTGCCGTATAACTGCAGACGAGGTACCATGGGTTGAACGAGTATGTACGGCGTCGT
TAGATGTCCGCCACCCTACGTAACGGAATTCTGCGTCGCTGCACACCAGTGGGGACGTGGACATGCCATGGAACGATGACGAGTTTGTAACTGTAGGAGG
GCTATGAATAATACTGCGAGTTCCATGTCAACTGAACAGAGACTGACTTGCAGAAGAATTCTCATTGAATATGTATTGGGATACCCTGTGTAGTTTCCGA
ATTGTCGGTAAGCCTGCGGCGCCTCGACGACCTCACTAGAGAGGCTAGCGGGAGACTGAGCAGGATCTTTGTCCGTGACCGCAGTGACGGTCAATGAAAT
ACTGCAAATTACGGGGCAGCCGACGGTCTCAAGAATGAGTACGCTTAGCGTGGGCGCATCGATTCAATCTGCAACTGTAGCACATGTCTCCGCTCAGGAA
GCGGAAGCACCGCTCACGGCCGTCCACATCGGGAGGGATTTGGCACCGAGCATGACTGACACTCGACCAGAGATAGCTCGTCGTGGTACCACTGGAGTAC
AGAGCGGAGAAATATACACGAGGACTACAGAAGCGAGCGCTCGAGCGGCTAAACGGACCGCCAAACCATTCAGAGACGCTTGCCAGTCTGTTACGTGATA
GCCGACAAACCGTACCGCCTCGCAGTAGTTCCGCCGCGATTCGGTGAGTCGTCCAAAAGATGCGCCATTGCTATTCGCCAAAACTTGTTCACATAGAGTA
GCATCAATGTGACGCGGTCCGATGTGTTGATATTGCGCTTCATGTTAGCCAGGACGCAGCGTTTTAGCCGAGGCATCAGTCGCCGGATGTGGTCGAAGAA
CAGCACATCACCCACAGAGAAGACCACTGATGGTCGCCAATAGATCATCATAAGTCTCCCACTGAGGCGTCGTCGCCGGCAACACGACATTAGCCCGAAA
TCCATCGCAAAACTCACGTACATCGAACCTCCGAgtagctgcttcatctccgtCAAAGGCCTGAAGTGCATGATGGTGAGCTGCGGCTACCAAGACGGAC
ATGTGCAAAGCCATGAGGACAGGGTAGATATCTAGAAGCGGATGCAGTCGAGTTCACACAGATGCAGGACAAACGAACATGGG