Description :
From Genome Similarity Track
Location :
Scaffold_130:76824- 80032
Sequence
3208 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNGGCAAGCGGAGGAAGGAGATGGACGCTCAAGGCTGGAAAGAAGAAACACGAGTACGTGGGACGGAAGTAGTTTTAAAACATGTTT
AAAACAGCTCTAATGTTTTTTTTTGTTTTAAACAGGACGAGAAAAAGTTTGGAGAGGCTGAAAATGACAGCTACAAGCGCGGATGGAAATAATTTAGAGG
CTCACAGTCTAGTAGGGATCGATCTCTATGATTTCTTAAAACATTTTTTGACAAGCGCAATTAGCAAGCAAATCAAATAGCAGTAGCTGACAACGTAAAA
TTTTAGCAAGGTATTCTGTCTTCATCTTTGGTTGATGTGTCAGCCTACGTGCATAATTTATTTGTGAAAAGGAAGCTGCTTTATAAAAACTGCTTAAATG
AGTTATCATACGATTCGAAACTGTTATGACAGGGTAAACGAAATCACTGGATTATCACGGGATTCTGGATAAAATCCAGAGCAAAATGATTCCCCTTCTG
TAACATCACCTTCTTTTCCCGCTTAGGTACGGGTCCAACATTCTATCACCTTTTCTCTCATTCCAGATTCATAGGAGATATTGTAACGGGGTACGTAGCC
CTAAGTGTACCCTGGTTACATGAAGTGTGACACTTCACACTTCAGGAGTATGACACGTCATACTCCGGGATAATTGGTACCGAACGGAAAGTAACGTCTA
ATTCATGCTTATAAAAAGCTGAATAACGCGACGGTGCCGGCCCAAACACCAATCCCACGAAAGGATGTGTTAATAAACAACATGGCCGGGAGCGTATTGT
AGAGTGCGCTGGATTTGTCGACGGATACTTCCAGATCCTGATGCGAGAGAGTGACATGCCCCCTCGCCTCGCCGAGGGGGAGCACTCCAAGCGGCAGTCT
TTGGGGAGTGGCTCGCTTTAAACCCGCAGGGCCTGTTTCTAAGGCCCGCGGGAAAATTTCATCGCCTGGGTGAAGGCAAATGTTTTCGGGCCCTTTGTTT
GCCTCTCGCTAAAAGAGGTCATTTCCAAGAACATATATTGCTCCCCATACCCTGCCCAGGAGGAAAGAACGGTCATGGAGGTGCATCTGGGGCACCTCCG
TCGAGTGTTGAACGTAATGCGAGCGAACAATCTCTACGCCAACATCGACAAGTGCGTTTTCGCGTCACCAGAGATTAAAGTTCTCGGTTGCTTCGTAAGC
AACGTGGGCGTTCGGGCCGGCCCAGACAAGGTCAAGGCCATAGCAGCCTGGCCAACGCCCCGATCCCAGAAGGATCTTCGAAAGTGGTTGGGCTTGGCCA
ACTACCTTCACAGGTACAGCGCAGGGTACGCGGGCTTCGCTAAGCCCTTGTCGAGCCTCCTTCAGAAGGACGTCGACTGGCGCTGCGAGCAGGAGCACCA
GGATGCTTTTGACAGCACCAAGGCCAGTCTCCAAGAGGCCCCTGTCCTGGCCCTGCCGGACGAGACGAAGCCGTTTAGCGTCGTCTGCGATGCCTCCGAT
AAAGCAATCGGATGTGCATTGCTACAAGCCGACACGGTTGGACACGAGCGAGTCATCTCGTTCCAGTCCAGGCAGTTTAAAGCCGCCGAGCGGAACTACC
CTGTCCACGACAAGGCGCTCCTGGCAATGAAATGTGCCCTTGTGAAGTTTCGTGCTCACCTCCTGGGCTCCCGGCCCTTCGTGATCTACCCAGACCACGC
GTCCTTGAGGACGGCGACTAACTCGCCTCAGCTCTCCCAAAGGATGGCGAGGTGGCTGTCCTTCTTCGTGTAGTACAACTTCCGTGTCGAATACAAGCTG
GGTAAGCTCAACGTGCTTGCGGACGCCCTCTCTCGGCGTCCTGACTACGAGGTGGCCCACATCACACGGGTGACAACGGATCTATATGATCGGATACGCA
TGGCGTATCGGGACGATGAGGCTGTCGCGCCTATCATCAAATTCCTCACGGCAGGAACGAGCGCGAAGTCCGACTGGCTCTCGTCGCGACAGCGCTCATG
GCTCCACCGATACGAGTTGAAGGAGGACCTCTTCTATTACCGGGTGGAGCCCACTTATCCTCCACGGGTGGTCGTACCCAACGACGAGGATCTGAAGTTC
GATATCGTCGCGGAGGCGCATGACGCGCCCTCTAGCGGCCACTTGGGCCGCGAGAAGACCTTTCTGTCGGTCTCTCAGTCCTTCTGGTGGACCCACATGT
ACAGGTGGGTCGCCCGGTACGTCAAGACATGTGAAACATGTCAGCGGGTCAAACCCGCAGGGCACTCTTCGGCTCCACTACAGAGTCTGCCCGTACCGGC
TGACTGTTGGAAGTCGATGAGTTTTGACTTCATCTTTGGGCTTCCCGCCGATGGACACGGCAACACCGGAATTTTGGTGTTCGTGTGTCGGCTGAGCAAG
ATGGTACATCTTGCTCCAGTTCCCGTCACTGTTACGGGCGAACAAACCGCAAGGTTGTTCGTCGATGGCGTGTTCCGCTATCACGGTCTCCCGGAGACGG
TTGTCTCGGACCGAGACCCGCGATTCACTGCTGCGTTTTGGAAAACGCTGTTCCCTTTACTGGGAGCTCGTCTGCAGATGTCCACTGCGGACCATCCGCA
GACAGACGGCCAAACAGAGCGCGTCAATCGAGTGCTCGAGGACACTCTGCGCAGTGTGTGCGCGGCAGCGCCACGTACGTGGTCGACGCAGCTTCCAGTT
GTTGAGTTTGCGCTCAACAACACGGTGCACGCGTCCACGGGGGTCACGCCGTTCTACTTGAACGGCTTCCGCCACCCCAGAGTGCCTCTCACTCTTCGAG
GAAACACTGACTCCTCTATTCTAAGTGAGGGAGAGGCTCGGAAAGCCCTTTCCTCCCAGGTCTCGGATGTAAACACAGTTTCGCTGCGGAAACAGGTGGA
ATCCTTTATGGATACAAAGCTGAACATTGTCAGCAGGGTCCGCGATGCCATGGCAGCGGCCCAAGATAAACAAAAGGAGTACTCGGACAAACAAGGAAGA
GGAAACTTAAGTATATTTGAGATTGGTGACTTAGTGTACTAGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNN