Description :
From Genome Similarity Track
Location :
Scaffold_64:7681- 8921
Transcript NameFunction/comments
Physo_138475putative polyprotein
Physo_109145putative polyprotein

Sequence
1240 bases(100 bases per row)
AAGGCCCTCCTGGTGGCGAAAGGGTTTAAGCAGAAGTTCGGCGTGGACTTCTTCGAGACGTACTCGCCCGTGGCCAACATGAACTCGATCCGAGTGGTGT
TGTCGGTTGTGGTGGCCGAGGCGTACATCACTGAGCAGCTGGATGCGGACACCGCCTTTCTCAACAGCCGCCTGGTGGAGCGCGTCTACATGGAGGTGCC
CTATGGAATCATCAACGCGAAGAACATGATGTATCGGCTGCAGAAAGCGACCTATGGTCTGAAGCAGGCGGCAAATGCCTGGCATAACACCATCCACCGA
GTCTTCGTGGGCATCGGGTTTCGGAGCTACGGCGGTGACCAGTGCGTTTACGTCAAGGGCGAGAAGGGCAGGTTCGTGTAAGTCTGCCTGTACGTGGACT
ATATGACCATCGCAGCCAAGACGTGCAGCGAGATCCAGGAAGTCAAGGTGGCGCTCAAGAATGCGTTTAAGATGAAGGAGGTGGGCGAGGCCAAGTTCAT
TCTCGGTATGGAGATCGACCATGACTCATCGGCGAAGACTCTCATGATCAAGCAGACTCGATACATTGATGATGTGGGGAAGCGGTTCAACCAGCAGGAC
GCCAAGGTGGTGGTGAACCCGTGCGAGTCGGGCATGAAGTTGTCGAAGCCTCAGTCGACGACGACTCAGAAGGAACGCGAGGAAATGCAGGCGAAGCCCT
ACCGAGCACTCATTGGCTGTTTGTTGTACATTACAACTTGCACCAGACCTGATGTGGCGTACATCGTGACCCACTTGTCACGCTTCCTCGAGAACCCCGG
GCAGCAGCACTGGAAGTCTGCCATCCGCGTGCTCAGGTACCTGAAGAGCACCCGAGACATCGGCATCGCCTGCAATGGGAACGCGAAGAAGGTCGAGGTG
ACGGCGTACACCGCCGCCGACTGGGACAGCAATCTCGACGACCGACGCTCGGTCTGGGGCATCATGGTAATGATTAGCGGGGCGCCGGTGGTCTTCAAGT
CGAAATACCAGCGCACGGTGGCGCTCAGCTCGGCGGAGGCCGAGTACATGGCGCTGAGCCTGTGCACGCAGGAGGTGCTGTGGACCCGCGCCATGCTCAA
GGACATGGGTCACGAGCAAGTGGGGGCTACCCAAGTATGGGAGGACAACCAGGGCGCGATCGCCCTCGCAAGCAACGCTGGGTACAACGCGAGGACCAAG
CACGTGGGCATCAAGCATCACTTCATCCGCGAGAATGTGT