Description :
From Genome Similarity Track
Location :
Scaffold_42:768- 5476
Transcript NameFunction/comments
Phyag_g1039U3 small nucleolar RNA-associated protein, putative
Phyag_g1040hypothetical protein

Sequence
4708 bases(100 bases per row)
CGTACCCTCATCGTACCCCCCTCGATTTTGCCCTCGATTTTAGCCAGCCATTCCATCACTAGAAGCAGCGTTAGGaccatgtcgtcgctgcgcaACGTCG
TCAAGCGACGCGAGCACAAGGAGCGCGGGCAGCTCCGCGAGCGCCGCAAGCTGGGTCTGCTCGAGAAGCACAAGGACTATGTGAAACGCGCGCGCGACTA
CaacgacaagcagaagcggctgacgacgctgcggctcaaggcggcgctgcgcaacCCGGACGAGTTCTACCACCGCATGCGCGACagcaagacggaggac
ggCGTGCACGTGTCCACGCACAACCACCTGAAGCAGGTGGACACGCAGGCGCTGCgctcgctcaagacgcaggaCCTGGCCTACCTGCACATGAAGCGCG
CCGTGGACCTGCgcaaggccgagaagctcaacCGCGGCCTGCACTTCATCAACGCGCCCAAGACCAACACCCACACGGTCTttgtggacgacgaggagca
ggtggacaCGTTCAACGTCGCCAAACATTTCGACACGGcgccagaactcgcggacCGCGCCTTCAACCGCATCCGCAAGCGCGACCTGGAGACGGCGCAG
CTGTCGGACCTGGGCACCAGTCGGAAACAAAAGTACAAgatgcaggtggagaaggacgccGTGTACAGGGAACTGAGGGACCGTCTGTCGCGCGCCAAGA
AACTCGGACACATGAGTGCCAAACTGGATCTGGAACGCAAAGTGCAGGCCAAGGGAAACAAGATGAAGGTCAAGGGGGCGATGGACGGCATGCCTGCTGT
CTACcgctggaagcagcagcggcagaaGTAAAGAGATACAGGGGAGAGCGAGTGGATTTCATACACTACATGCAGTTTTTTAGAGGGTTTAGAAGGGGTT
TATGCTGCTGAGGAGAGGTGATGTTTAGGTCGACGCGGAGGAGGATGGTGATGGCCGTATGCTTTACGGATCTGGAGGAGAAGTTGCAGGATCACGGCGC
GAGAGCCACTGTAGATGGCGCTCGCACGacggagcaggtggagaGGCATGGTCTGACGGACACGATGTTAGTAAGGAAGTAGAAAGAGGTGGAGGATGTT
GGCTtaccttcttctgctgcaggatggtGAGCGCCTTGGTGATGTTGTGCAGCGCGCTGGCTTTGCTAAGCTGGTGATTACCCGATGGACGTGTGATGCC
TGGGATACTGCGCATGTactccaccttctcgacgATACAGCACAGCAACACGCCGGACTGGAATTCTGTCAATGGAGCATTCGAGTCCTGGTTGCATTTG
ATTGAGATAGCAAATGGAGCGTGAGTGTGGTATGATGAGCGCTGGGTGAAGCAAATGATGCCGTACGTGGAAAGCCGAAGCGTTTTCGAGGTGGATACCC
AAACGCTTCAGCCATGCTAGAATTTCGTCGACTAATGGCGTGGTGGCGTTATGCTGTGCATCAGCTGTAGACGGTTTGGCCGCGAAAGGGACCACCGCGT
CACTATCGGGACTCTGCTTTGCAACCTTTACTGGGTCTGCGCACGCTGCTACCAGTGAGGTTGTTAGTGATAGATTTCAATCTGTGCGGGGTATTGATGG
TGTAGACTTACCTGACAACTCCGCCAACGCAATTTTCGGGGCCAATCCGTCCGATTCCTGAAAGCTTCCAGCTGGACCTCTCCGATCTCGACAAGTCGGC
AAGATATCGTCCATATTTTCATACATCATGTCGCTCTTGTGTGTCCCTTTTGAGATATCATTGTAGACTGGACTGGAAAATGGTGCGCTCGGTACCGGGA
AcacatcatcgtcgtcttccatgTACTTTGGATCACTTTCGCTCCATGCAAGACGGCGGGCAAAGCTGTCGTGGAGGTTAACCTGGAGTGACTTTTCTAA
TTCACCTTTGATCACAAGTTCACCGTGGCCAACTAAGGCAACGGCAGGAATATCAAGCAGTAATGGAGAAGCCTGCACAGGAGCTGATTGTTCCCCACTT
TGCTCGACGACTTCAGCCTTTTGGGTTCCATGCAGATCTGGAGGCGCGAATTCAACACCCTTTCTACCAGTAGCTTTTACTAGCGCAAGTTTTGCCCGAC
TGACCTGCCATAGATGCCATAAAATTCCGTAGTTGATCTGTCGGTCCCCAATGAGAACAGCTTGCTCGGCAGATGAAGCCAAATAACAGAGCGGAATCTG
CCCGTGCGGTAAAGCATCCATTCTTTCAAACGCCTTTGCAATATTTTCCctgcgaagaagcagggGGAGGTATCAAGTCGTTGATGAAAAATGTTGCAGC
AAGGAACTCTCATTCGACTTACCTCATCTCTGCCAAGGTTCGAGGGGATTTGAAATACGAAAATGGCGCAGTTTTCAGTACTTGAGCCAGCAGTGAGCTG
GAGGCAGTGCAATAGATCAGAAGTTTTACATCGGTTCCAGCATAAGGCGCTTAACATTACCAGAGTAAAACGCCGTTGCGCATCGGGTCATTCAATACTC
CACGACCTGAAGCCTGCAGCATTGAGAGATATGTGAGATCACTTACTTGGGAATAGCGTTAAATTGGCACTTCAAACCATCTTTTTCACATCGTATCCGA
CACCGACGAGCCACTCGTCCACCGCATTCATCTGTTCGTTTGTTATGTAAGGCAAGCTCTGCTTCAACGGAGCACATCCAGTATGTGTAATTTCCATCAC
AACAGGCTTTACTTTTCGACGATGGGGTGACTGGATGTGCTTTGGGCTGGAGATGACGGCAGTTTGATCGTCGCCATTCTTCACGGTGTACGGATCGCGG
CCGTCTCGGTTAGTCTCTGGGGCTGCATCCACAGAAGTTTTCATATTTGACgcagcaagtcgctgaaCCCCATTCAAAACTTCATCTAACGCACACCAAA
TCGTTTCGGGTGGAACGTGTTTTCGTTTGCGTTGCACACATTCCAATGAGGCAAGAGCTTCAGGTGAAATCCCCAGGCCTTTAAATGCAGCTAGGGCTAC
AGCAAAGTTGTGCCATCTCGATGCTGGTGTATTCGGGTCACTCGCGATTGCAACATTCTCGAAACTCAAATCTTTAGTTCCAGGATGAAGTTGTCTACCA
TAGCGCCGaacgatggcagcagcgattcGGGACAACAGATCGCCACTCGTAAAAACTCGTCGAATTTTCGTTGGTGAATGCAGTTTCCATTCTTCTGACT
GTTTGTAGAAAATTTGTTCGAGGGGTAATTCAACATGCAAAACATATCGAGCCCAATTGCAAAAGCGCGCTGCACGAGCATCGTCACTATGCCGAGAATC
AATATTTTTTCTGCTTGAAGGTTCACTGCGACGCTGGCCCTTTACAGTTGGATCAAGCATACCAAACACGTGAAGTCCATTGTCATCGTGAAAAATGCTG
GCCTGATTTGGTatcttcttgttgtcgaCAGCTCTCGGAGCACACGCTGCGGTTCTCGAGGCTGGTTTGCCGAGTCTTCTCTTCGCTCGAGCAGTAGTCG
GCTTGATTCTGCTTTGCCTCACTACTTTTGATTCTCGTTGAGGGGCATCTGGCATTCTAGCATTCTTGACTGGTTTGGTAGAATTCACTCGATTTTGCGA
TCGTGACGTGGATGCTTGCACGCGTTTGGGTTTCTGCCTAGGTTCCGCATTCTCTTTGGTTTTTCCTTCCGACGATCGTGTATGCTTCAGAGAAAGCTCC
ATCAATGTTTCTTGTGCACGGCGTCGGCGGAGAGCATCCAGTTCATTTTGATGCTCCAACATGCGCTGAACGCACAGTCGCCTCAACACGGTGAGCACTG
CGCAGATGGCGTCATTTTGACCCGCCATCACTCGAGCCACACAATCTGCATCGTTCACAACGTAAATGGCACCTCTATCTTGACTTCGGCATTCCATCGC
AACAAACTGAACCACACGACGGAGACGCTTTTCAATCTTTTCATCTCCATATAATTCGTCTTCCAGTGGAGTGGCTAAATTATGCTTCAAAACAGCAGCA
TGCACATGAGTGAACAGCAAAGGAAAAGTTATCGCACCACCACTTACGATACCTGCAGCCACTCCACAATTTCGTACAGCACGTCGCCGAAGCGCAAGTC
GCGCAGTTCCTCGACCAACAAACACGTGGTGAGTGGCAGCGAGTTGacccagtgcagcagcagccgctctCTCATTGAGTCCTCGTGTTCCTCCTCATCG
AAGGATGCAGTGAGCTCCATCGTTGCTGACCCGGAAGACTCGCACTCGTCACTACTGCTCATACTAGTCATGGATCTTAAAGGGTCACAGGCCGAAAACC
GTCGTAAATGCTCCAGGCCTGATCAGATTCGTAGTGCTGAGGTGACTGGGAAGCGCTTCCACGGGCACATCTAaaagctgctcctgctgccaagaagagg
CCAACTATGAGGATGCACCTCCGAGTGCAGCGTGATACCGCTCGTCTACCGCCGCTTGGAgcagccaagttgaagccgcaTTCGGTTGTTGACTCCCTGC
TGCCAAAGGAGCGACGATCGCAGTTTCCGCGACTCACGATTGCCCAAAGCCGGACGGTGAGCGCGGGCTTTGCACTTTGGACAATTCGATCGCCAAGAGA
GAAGGCTCGGCCTGACGTGTttgcctgcagctccttcataGACGGCACGGAGAGAAACTCGAGCCGCGTCCATGCCAAAGACCATCGGCTCTGGCCCCCG
AAGGTGAC