Description :
From Genome Similarity Track
Location :
Scaffold_1340:768- 4608
Transcript NameFunction/comments
Phypl_g13149acetolactate synthase small subunit, putative
Phypl_g13150lysosomal beta glucosidase, putative

Sequence
3840 bases(100 bases per row)
gtgATGACCCAACAATACATTCTGGTAGCACTCTAATTTGATTACGAGCAGTTGACCAAGGTAGATGACCTACACTAGCATGCTTGCTCCACTTGCTTGA
TAGCACGCCTACGCCAAAGCGCACATTCGAATGCAACCtaccaagaagaaaaaaaagcgAGACCGTAAACGCTACCGACAACCCCTTGAACGCTTATCCA
GGCGGAAGACGGGAGATGTCgatctcttcgtcgtcagccTCGTCCAGAAGCGTGCGCGTGGCGCCCTCGAACGTCGAGAGGTCGCCCAGGTTGTCAGTGA
CACTGGTACTACGAGCCATGGCAATGACACCGCTGCGGTGGATTTCCGTGATCCCCAGCGGCTTCAGCAGGTCCAGGAAGGCCTCAATGCGGCCAGGGGT
GCCGGCCAGCTGCACCATGATCTGGTGCGGTCGCACGTCGATCACCTTGGCGTCGAACAGGTTGGCAAGCTCCACCACTTCGGCGCGGGATCCAACCTCT
GCACGTTGCAACACACCAGCAGGAGACAATGTTAGCTCCATGTACAAGGTTTCAGTGGTGCCACTGCCAGCACTCTTTACAGCTTGTACGTACCGGCTGT
GGacaccttggccagcatcaGGTCGCGCTCCACGTAGTTCTTCTGGGCGTttttgccgctgctgaggaTGTTGACTACAGCCACGTACACGacgtcctcg
agctgcttcttcatctgcaaCATCACAATAGAGTACAACCAACAATGGTCAGCCACCTTCATACCCCCCTTCCGTCTGTTAACTACTCCCCGTACGTTGA
CAACACTCTGCGCAGTGCCGTTGACGACCACAGTCATGCGggagagctcctcgacctccGTGCGGCCCACCACGAGGCTGTCGATGTTGTAGCCTGCAGA
AAACACGTCCAGACACCCATCAGAACCTTCAATTCGACCTTTATACTCTGGAAATCTATAGCTACCTCGAGCGGCGAAGAGGTTGGCGATCTCGGCCAGA
CAGCCGGGCTGGTTGACCACCAGCGCGGCGATCACGTGGCGCTGGCTCTGCTCCGACACGCTGAAGGCGCGCGCAAAGTACTTGGGGGTGGCGCAGGgcg
gcgcgagcgcggccgccgaACGCGGGAAGGCGCGACGCGCCAACGGCAGCACAGACCTCCGCAGCATCGTGCCGAATGTCGAATGTGGCGTctgaagctc
gtggcggccgcaGCAACGCAAATGCGCAAACAGCTCAAATCCTGATTAAGTACGATCGAGCCAAGTGACAGGCCTCCCAGGAAAATGAACGTGGatctgg
tgctggtgctgctgggctggGCGTGCTGCGGCGCAATTGGGCACGCTCTCCCCGCAGGTGCAACGCCTGCTGCGCATGAGCTCGTGTACGACCCCGACAC
TGCCGTTTTCGCCGCTCTCCAGGGCGCCGTCGAGCCCTCGGACGCATCCAATGGCGTCGACATCGACGCTCTGCTCGCCAACATGACGATCCGccagaag
gcggcgcagatgaCGCAGATGGACATTTACTCCATGATGGACGGGGACGAGAGAGACCCGAAAAAGGCTGTGAAGCGAGAGGTGGTGGCTCGGTACGCTC
GCGCGGGCGTGGGCTCCATCCTTAACAGTCCGTTCGCGGGCGGGCCCGTCGGCGGACGCACGGGTTGGAGCGCCACGGACTGGCGAGAGGTGATTCGCCA
GATCCACGAGATCtacaaggaggagggcgcTGCGGTGCCCATGCTCTACGGGTTGGACACTATCCATGGGGCCACCTACGTACAGGGTGCTACGCTGTTT
GGCCAGCCCAtcagtgctgctgcctcgttCAACCCCGAGTTGGTGTACAAAATGggcgctgttgctgctaaGGACACTTTGAGTGCCGGCATCCCGTGGA
TCTTCAGTCCGGTGCTGGGTATTGCAGTGCAGCCGAAGTGGTCTCGCGTCTACGAGACGTTTGGAGAAGATCCTTTGGTCTCGTCGATCATGGGGGCGGC
TCTGATCAAAGGACTGCAGAGCTCGGGCAAGGTGGCAGCCTGTATGAAGCATTTTATAGGATACTCGGACGTTCGTGAAGGACTTGACCGCGCTGACAAT
GTCATCACGGACTGGGAGCTCGTTAACTACTTCGCGCCGTCGTTCCTCGCTGCCGTCCGTGCTGGCGTGCGGACGGCGATGGAGAGCTACGTTTCGGTGA
ATGGCGTTCCGGTGATAGCCAGCAAAAAACTATTGGTTGATCTGTTGCGGCACGATATGAACTTCACGGGTCTGTTGGTCTCGGACTACAGCGAGGTAGA
CCGTATGTACTCGGAGCACCATTTAGTGCCCAGTGTGGCTGAGGCTGTTCGCGTCACCCTTCAAGAGACATCGCTCGACATGAACATGTCACCGAACTTG
CAGGCATTTGGTGACACCATCGAATCGCTTGTCGGGAAAGGACTCATTTCTGAAAGCCGTCTTGACGAATCTGTTCGGCGCATTTTGGAAACCAAACGGG
GCCTCGGACTACTCGATTCGGGTTACTACGATGGCTTTGAGCGAGAAAGTATGGTGAATACTGATTCCGTCGGCAATGCTGCCGACCAAGGAGacgcgtt
gaagttggctcAGGAGTCCGTCATTTTGCTTGAAAACCATAATAGCGCTCTGCCCATTAACCTGAAGAAAGCGATGAACGTGTTTGTCACCGGCCCTGTT
TCGGACAACAAGGGCTTTCAATGCGGTGGGTGGTCTGTATTCTGGCAAGGatccagcgactcgacgcTTTTTCCAAACGGTGTCACCTTCAAGGAGGCCG
TGCAGGCAAAGGCGGCATCTTCGGGTGGACAAGTGAAGGTCGACCATCTCGAGGTTGTGGATATTGATGGCAATGTGAACCCCCAAGACTTCCAGCAGGG
GCTACAACTTGCTGCCAAGAGTGAGTACACGCTGGTTGTCGTGGGTGAACCAAACTATGCGGAGAAAACTGGTGACTTGCTCGGAAGTATGGCCTTGCCC
GCTGGACAATTGTGGTACCTGGAGGAGCTTACAAAGCTAAACTCTACCAAAGTGATCGTCGTATTGGTCTCTGGTCGTCCCCGTTTGCTTGGGGGGGCCC
ACAACCACGCCGACGCTGTTATCCTGAGCATGCTGCCTTGCGAGCAGGGCGGTCAAGCGCTGGCAGACGTAGTTTTTGGCGACGTCAACCCGTCAGCACG
GTTGCCTATTACGTATCCAGCCCGCGGTACCCAGCTGTTGCCGTACTTCCACCGCGTTAACACGCGGTGCCAGCCGTACGAGGAGTGCCCCGTCCAATGG
CAGTTTGGACACGGGCTCAGCTACACGAAATTTGAGTACTCAGCGCTACGACTCAACTCCACCCATGTGCACGCTACGACGGGCGCGTTGAAAGTGGCAG
TCACCGTGACGAATCGTGGCACTCGCCCGGGCAaagacgtgctgctgctgttcgtaTCCCAAAAGTTCCGGCGTGCATCTGTGCCCGAAACCAAGTTGCT
CAAGGCGTTCAAaaagctggacgagctggcgcccGGCGCCAGCCAGGATGTCGAGTTCGTGCTCATACCGGGAGACTGGAGCTACTATGAACCGCACGTC
GTGGGTCGCGGCTTCCAGCGACGTGCCGAGCCTGGCGAGTTTGTCGTCTCTCTGCTGCCATCCCCAACGGACAgctcgacgatggcggcgccaAGTTCAC
TGAACGACAGCGCTGAAAGGTACATCCAGATGAAAAACCGTGGCAGCCCCGGCAGCACGGTACCGAGCAGTTTGGAACGGCCAAGGGCGGCGGCAGAGTC
TGCCTCGGGGATGAGTGTTTCGTTCTTCGTGGTACCTTAG