Description :
From Genome Similarity Track
Location :
Scaffold_130:768- 2092
Sequence
1324 bases(100 bases per row)
TTTTATGGTATGGATGAATATACACGTCTTTCTGACAGACACAAAGGCAAGATTGTGAATATGTGATTAATATCCAATCATATACTACAATGTACCTTAT
TTCAGCCAATTAGGTCGCACAGGAGCAGGCTCTTCATTCCGACACTTTCTGACAAATATTTGTCGGAAGCTAGAGCTAACTATTTTGAAACCAATACTGA
ATTTAAGTCGTGTAAGATATATGTCAATATTTTTGTGGTTCCGACAATGCGGTATACCTCCTACTTTAGGTTAAAATTGAGCAGTAGTGTTAAGGTACAC
TCAACCAGCCAAGTCCAGTTAACAAAAAGCAGAAAAGACAAGCAGCAACCAGCATGAGCCTCTCCGCACTTATCCCTACAAACACGCAAAAAGCGCGTAC
TACCGGAATAGGCGCGTTCGAGCGTATGCTTAAAGTCGAGGATGTATCCATGGACGTTGTCCGAGCATGCATTTTCAGTGACAGCTCTGGAAAGAGCTTA
GCGGCCGTGATGGATCGTTTTGGCTACTATCTCGCCACATGCGAAGGTAAGAAAGGTAAGTTGGCGCCCAACACCGCCATTTCTTACTTTAGAAACGTGA
AGCTTTGGTTTTTCGATGAGTATCCTCATCTTAGAGTACCAACCGAGCTAATTTTGCTTAAACAAGGGAAGACTCTCGAAAACCACTGCTTAAAACGTGA
TAATGGAGGATTTACTAACAAGGCGCCACCTTGTACAAAGGCGGATTTGCGCTCACTAATATGCTATGTGTACAAAACAGCATCCGTCGCCTCGGATTAC
GAAGATGCAGCGCTTGCGTGCCTTATGTGGCATTGCTCCGGCCGTTCATCAGATCTCGGCTACGTCACAAAGCAGCACATTACAATGTCAGCTGACAACG
TTTTCTACATTCGGATGCTACGAATAAAAACAGCTGAGGAGCAAGGCCTCACGCTCGTACCTGATCGGGCGGATTTGGTGACCTGCCCGCTGCACACGCT
CGCAGTAGCCTTGGTGATGCAGGAGTCGCCTTGTGTGTCCCTGCTAAGCCAGTTTCCTTCTCTTGTGACACCGTCTGCACCATCACTTGATGCAGCAGCA
CTCCTTCTCGATGTACTACGAGTACCTTCGGTCAATGCTGCCACCTCTTCGCAGCTTCCTGCAGCAGGGATGACTGACCCGGCGGCTGCCACTCTGCGAA
GCGTCCCGAGCTCTGCTGCAGCCAACCCTTCAGCGACCAATCAAGCTCGCGGTGACGACGGGTTCAAGCGTATGTGACCGGTTCCTGAAGCCGGTGTCGA
GCCGCAGAGCCTCAGCCAACTTGA