Description :
From Genome Similarity Track
Location :
Scaffold_180:76797- 80792
Transcript NameFunction/comments
g6656.t1POM66573.1 Hypothetical protein PHPALM_17548 [Phytophthora palmivora var. palmivora
g6657.t1hypothetical protein

Sequence
3995 bases(100 bases per row)
TGGTCCAGCCCGAATAGGCATGGGACCTCCGGCATCTTCTGGCGCACTTGCTGCCACGGATGAGCCGGATTAGTCTAATCCGCCAGGGCCCGGATCCCAG
CAACCGAGCACGGGGACTCGACGCCCTTTGCAATAGGCGGAGTCACGCTCTGGTTCTGGATCTGGCACCAGGCAGTTTGTGCGCCTGGTGCCGTGAACCC
AGGGGTCAAGAACGGGTTCGCCAGCATCGAAAGACGCTGGGAATCCACGCTCCCGGGAACCGTCGGCACGGCCGGAGCGAACGAGTTCGCGTCCGTGCCT
GGGGCGGTCGACAGCGTGGCCGTGACCTCGGTGTGCGCGCGACGCGTCGCAGACCGAGCCGCCGGAAGACGTGCGCGTGGCTGGCTAGCCGACGCTGCAG
AAGTCTCTGGGGCACCCGCAGCCGACCCAACCGGAGTCGCCGGTGTTGGAACCGACGAGACCGAGGGTGGCGCCGAAACCGGCGGGCCGACCGAGGTCAC
CAGCAGCCATAGGCGTGGCAGCCGGCGACCGAGGAACGGCCACCGAAGCTCCGGCGGAGCCAGAAGCAGCGGATGGAGTGCCGCTAGCATCCTGTGAACG
TGGATTACGGTGGATATAAGCACCGAGAGGTCAGGCAAGGTTCAAGGAGGATGAAGAAGCAAAGAGAAGCAGGAAACGAACCTCTCCGGATGCATCAAGG
GCATGAAGGGCGGCGGCCGTAGCTCGGTTGAGCAACGGCGAGCGGCGAGCCATCAGGGCGCGATCAAGAGGCGCCGCGACGCGCACTACTTGCGGAAGCT
TGCGTCGAGGCGGGGGCAGTTGTGGCGTTGGGTTTTGATGCCGAACTGTCACGGTTCGGCTGACGTTGCACCTTTCAGTGAACGGCGACAGAGCGTCTTG
ATTGGCGGGTCTCATTTCCCGCGCTATAGTGACCTAGGAACAATAGTGACCGAGGTCTCGGCTGGGTCTAATAAAACCCCGGCCGAGGTTAAAAGCCTCG
TTTGTACCCATTTCGTGTCGTACCCTCGGCGGTGTAGAGCCGGCTATACGATTTCCCACAGAGATCTGTTTACACTTGATATTTGTATAGAGATATAAGA
CTAGCCAAATGATGACCTACAGAGGCTCCCAGAGCTGTAGGATAAAAGAAATAAATCAGCAGTCTTCCCCACAAGCCACCAAGGGTCAAGTCCGTCTTCG
GTAAGTCTAGCTAGCTTGTCTTAGGGTCTGGATACGCTCGGCTGCGTGGGATGCCTGTCAGCGAGCTTGAGGTACATTGAACCGAGAGTTTGTTGCTGGT
CAGTCCAAGAGATAGGAGTGGCCGAGAGTTAGGGGCGACAAGGAGTGTCGGTCCCTATATATTGGTGGAACCCGAGTGTTCCCAAGTGTATTTCACTACC
CGCCGAGGTTACCCTCGGCAAACCCGTATTAGGCGTACCCTTACTTCTGAGGGACTGCGGGGGTTCGCGCGAAAGCGCAATATTGCATTCTAGCCCTCGC
TCGTGACTAGTAGTGCAGGTTTTAAGGTTGACCGAACTCAACCTTGGTATACAGAGGCGCTTACAACCAACCCGGTGTAAGGGATCGTTCCTGGTCTTCA
GGTGTTGATCCAACGTTCGCTGACCTTTCGCGAGGGAAGCGTGTGTTGTTGGTGGGACTCATACCGTTCGGTAGTGAGATTTTCTGCGTGTTCCTACACG
ACAATCGGGTACACAAGGTGAGCTACAAGTTCAAGATCCACCGGATCAATGGAGTACCCCCTCAGACAGTCGGCAGTTCGGGCAACCGTTGGTGAGTTGC
AAGATGCACGTCCGCTTCCATTGCATCCGCAGCAAGAGCCCTCTCTCTTCATGGTATGCGCTTGGGCATGAGCGATGACAAGTGTAGGAGGTGTTGTCTT
GCAACCGCAAATATGGGGGTTGAGACACGTGCACTGACCATACCTAAGCACTACTCGTCTGCGTAACTCGCAGAAAACGTCGGGGATTTCAAAGACTCTA
CACCATTTTGTGCTGGTCAGTGGCATTGGTATGTTTACCAGACTTAAAAGTGCTACCTAAGTCGTATTGTGCCATCACAGCACCATTGGGTCCCGCCAGG
CGTTCTCAATGTTGGACTGGTGACTTCGAATTTGGCAAAAAACGAAACTAACCTTTAGCCAAAAATTATCCTCAATACTGCGTTCTTAGAACCCCCCTAT
TCATCCAGGGGTGCCACTTATTGACCATGTAAAATAAAAACTTGATTTTACTTTTAAATCAGGTGTAAAAATGAGGGCGACATGGAATTAATTATCGATT
TATATGCAAAAGGGAGTAGATCGATCTCGATCTCTTGAACCCATCGGGAAATCGATCACGACGCTCGGAATATGGCATGTCCTAGCCCGGAATACTACCA
TACTAGTAGCTGCCCTAAATAGATCGATTTGTCCTTTCGTAGACCTCGAATTATTGTAACCCGATCTAACGGCTGCTAGTAAGTGAAAACGACAAAATCA
TTGCACTTCATGTAATACACGTAATAATCCGTGGGCGGAACCTGTATCCACTTCCATGCGAACAGCTCCGAATTTCTGTACACAATCGTAAGCAAATCGC
CACGACTGCAAACAAGAGGTCTCTAAGAGGCCAAATGCGACGAAGCAGCGAGACCGTCTCTCTGCTTCGTCGCATTTTTGGAGCAGGCAAGACCCAGGTT
CGAATGATTCAACAACTCCTCGGAAGCTCTTCATTGAAGCAACGTACACTGGGCAGCCGCTTGATCCGGCTTGAATAGCTCCACGCGTGTGAACGTACAG
TGTACATGTATTGGCAAAACTTACGATTGTTCGGGCATGGCATCACATGTACCGGAGACACCGAAGTGCCTGACAGGTGAAGCCATACCAGGTACTAAGC
TTAGAGCTACATATCATACCGTAGCGCTGGAGGTATGTACGGGTATGGACAGCGATGCCTCAACTCCACTCTGTTAGTGCCAGTTCCGGTGCAATGCAGC
TGGGCCAGAGTTTGGCTTTGTATCCCGCGAGGATGTCCACTGGAGATGCTCCAGGAGTACAGGTCTGTCCGGGAAAAGTTAGGCAAAAGCACATGGATCG
AACATCGGGATCGACTATCCAATACTCACTCCAGGAAGCATACATATTTTCAAGGAGAAGTGCTAGCTATTCCATTGTCAGATTCGGTCTTATTGGAGAC
GTAAATGCAGGTGTTGCTGGGCGCCTCGCCGAAGCAAAGGTGAGGAAACGTACCGCGTAAACAGCGCTGCGTTATGAACTGTACACGTATTACGCTGCTG
TTGTTCAGGTGTACGGTGCCACCAGTGACGAGGCAGACGATTTGACTTGATCTTCGAGTTGCGGCAAAACGGCTGGGTTGCGCTTTGCTTTTCGTGCGAG
CATCGGAGCAATCGAAGCGAAATCTTCATCCACAAATATTGCCACGCGCGACATCTTACACAAGAGCTGCAATACAGTCGAAAATCGACTGTACATGTAG
CAGTGCATGTATATATGTACTGTACAGTACATCTCGAATACGTCATGAATATCGTGCAGGCTTGCAAGTCCCCCGGCAAGGACGGTATCTAGACAAAATA
TGTGCACAGCATGTGTACATGACTTCGAGCGATATGTGCACTCAAAGTTTGAGTGCATGTGTTGTGCGTATATTTGAGTCTCAAAGTGACTACACGTAGT
GTATCCCGTTCGTACAGCCAAAGGCGTGTTTGTCAGTCGAGGACTAATAATTGAGAACGCGAGAAACACGAAATTGGAGTGCGAGACGGAGCAAGATACA
AGGAGAGATTTGAAACGCAGGACATCATGTTCGACATGGAGAGAGGCCGCCACTCTGGCGCGGACTGCTTCCTGTAAAGAGATGCAGCAGGATCGTGAAG
CCATCACCTTCACGATCTACTAAGACAAATCTTAGCATTGTCTGTATAATACGGTACAGTGTAGCGCGTGAAGAGCCAGCATTGCTGATTATGGA