Description :
From Genome Similarity Track
Location :
Scaffold_83:76775- 77886
Transcript NameFunction/comments
Physo_140205hypothetical protein

Sequence
1111 bases(100 bases per row)
GCGCGCTACCAGCTCGTTGTTCAGGCCGGCCACGTTCCACACGCTCACGTCGTACTGCTCCAGCCACGTCCGTTGAAAATAACCCCAAAATCCTCGCCAT
TTAGCTTTAGAGTACGCAATTCCAGCGACGTCGCAGCGCTGTCTGATCTCGCGTTTAACCCACTTGATGCATCGCTCAATCAAGCTGTGGTCAACCACCG
TTAGCATGTCGAGGACCCCACGGGTCATCGCAATGCCGCATTCTTCCTCCGGTATCAGGAACCGCTTCATCGCACGCCTGAGCGCCTGCTTCAGGTGAAA
CAGACACCCAATAACGATTGCGTTGGTGAACTGAGTCTGCACGGCATCAATTAAGGCGCTCTCGAAGTCGCACACGACTTCCGCCGGCTCAAGCTGTTGG
TGAGTGCTTTGCGCGACGAAATGCACCATGTCCCAGAAAGAATCGCCACTGCGAGAAGTGCTCAATACATAGTAGACTGGTACATATAGTCCAGACGCTC
GGTCAGTGCACCATAAAGATGACACATTGCTTGTACCCAGGGGGTACACAGCGAAATGTACCATCGACAAAAATGGTAGTCCCGTTGTAGCGAAGTAGGT
TGATGAGGGAGGGGTGTGCCCAGCCAATGAGTCGGGTAGGCTTGCTGAGGTTCTCGCGGTTCACCGTGACGTAATGAAACTGGAAGAAGGAGACAGCTTA
GTTCAGCACCGTTGAAAGTGGCGGAATTTCAATGGCCCCGTGCACGTCTCCGCTAAAGTGCTGGCTCCTTGCTTGGTACACACGGCGAAGCACTTGAGGC
TCAGATAGCCCGCGGACGACATGCTCGTTGTCAGCTCCGTAAAACTCGCTCCGCACAGCTTCCCATATGCGACGTGCAGGAAGCGCGACTTGCCAGGGTG
TCGACTCTGTCCTTCATAGCACTGGAGACGTCGACGAGGCTCGTGCCAGCAGCATCGACATTGCGGCAAGTGTGGGGGCGGCCAGCGGTGTACCCCATGG
TGCCAATGAAGAACGCCATCGTCCCGGGACAGCCCTGGCGCCAATGGCTGCAGCGGTAGGAGATTTCCTGGAGGATGCCCAAGCACGTATATACTTATAG
CCGCGGAAGTA