Description :
From Genome Similarity Track
Location :
contig_13:767694- 770137
Transcript NameFunction/comments
g2505.t1hypothetical protein L914_17079
g2506.t1hypothetical protein

Sequence
2443 bases(100 bases per row)
ATGCTGCAGCGGGTGTTGGCTCGGGAGAAAGTGGACGAGCGTCGGCGGGCGCTGTTTCGCGCTAGCGGCATCATCACGCAGCGCCACTTGCTGCAGCGCC
CTCTGTGGGATGTCGCCCATGCTGTGGACTTGTCGGTTCGAGAGACGGAGGTCTGGTTACCAAGTAATTCGCCACCTCGTGAATGTATCATTCTCACGGA
TTGCGACTTTTACTTGTGCAGGAATTGATCGCAAAACTTTCGATTCGACTGGCGCCAGCATGTCGTTCGGTAGCGTCAAGTCCCAATTTCAACTGCAAAA
CAAATGATACTGCAACGGTTTGCTGCTAACCAACTCTGGGTCAGGCCTTCGACCTCTTTCTGGAAAGTGCCAACCACCCGATGTTCCTGCGGACAGGACT
GACGAGCATCGACCAGGCTCTGAATGGGGGACTCCACTGCCGAGCCCTGTCGGAGGTGCAAAGCTACAGTTGTAGATTGAGGTGGATGTACTTGTAGCTG
ACGAGATGCTGTTGTGAATAGTTTGTGGGCACGGCTGGAATCGGCAAGAGTCAAGTCGCTATGACACTTGCAGTGATGTGCGCAATGGACTACCCAGACA
ACAGCGTCATGTTTTTCGACGTTGAGCACAACTTTAGTGCCAAACGGTTGGTTCACATGTTGCAAGACGATTCGTTGGAGCTTTTGTTGCTGCCGCTAAT
GTTTGTTGTTGATAGTTTGCTGCAAATTACCGTTGCACGGATACGACTGATAAATGCTGGAAAGGATACAGATATCAATGAGTTGGCTGCTGCTGTCATC
AAGCGTATTCGTGTTGTGAGGGTCAACTCGATAGCATCGTGTATTGCCAAGTACGATGATGAGAAAATTATTTACCGACTTGGTCCACTTAATGCTATGT
GTTTGGTGGTTGTTCACAGACTGAAGCAAATGGAGGACGCTATGTACTCGCTCAAGGTGAAGCTTCTCATTATTGACTGTGTCACCACACTCTTCCAAAG
GTGAGCCCAGCAGAGCAATCTTGAGGGGTATCTTATGTACCGGCGCTTAAATCGAATTGGAATGGTTTGATTGTCGTGCTAGCCCAACGATTTAACGCAG
GCACAGCGCCAGCATCACATGCTTCGGATGGCGAGAGACTTGAAGTGCGTAAAGCGAATCATTTCATTGCTGTTTTACTTGAGAATAATTGGTCTCTGCT
GCCGTCAGACTGTTCGCCGACACATACCAGGCATTTGTTGTCGTCACGAATCGGGCGTCCACTGTTGAAGGAGGGAGTAAGACTGCTGCATTTCTATCGG
TTGACAAGCTGGCTTTGACGTGCTTTTCTTGCATTGAAGGTGGACTCTACACAAAGCCGCTGCTTGGCGATAGTTGGGCTCACTGCGTTACCACAAGGGT
CGATGAATGCGATGGCTTTGTCATTTTTACTTCAACATCTCTGACATTTCCATGTGTGTATTACAGTTCATAATGGAGCGCCACGCCTCGCATCGTGCGA
TCACAATCGTGAAGTCATCCGTTGCAGGCTTTGTGGTTCAACCGTTTACTGTCAAGGTTCGAACTCTGTAGTAGTTTGCATAGTGCACGCGGATTTAACG
AAACATTCATTGCATGCACTGCAGGAAGGTGGCGTGGAAGCTGTCGAAGACTCGCGAGATGCAGCATCAGACGACTTTGCCATCCACGACGAGTTGTTTA
GTGATCTTGCACTCGCAGCAGTACCAGCAGTGGACCCGGCGTGTACTCTGCGCTCAACCCAGCAGAGCACCGCTGAAGACCCCGACGCAACGCAGCTGGT
CGGGCAAAGCGACGACGAATCTCCGCCACACCGAGAAAGCGCAGAGGACCAAGTGCAAGATGGCGTCGACGAGACCGAGAACAGCAGCTTCGACATTGTC
TCGGACTCCAACTCGGAAGAGGGCGATGAGTCGTTCAACTGGGACGTCACTGAAGAGTAACAGTGCAAGAAAATCACATACAAAAGCACAAACCCACAGT
TGATCAACGCCGTGTCGAAACATGGCGGGAAGCTTAGGAGGGTGTATTTAGTCCGACGCACGCCCAGCAACTAGCAGCTTACGCCTTAAGAGCGTAGCGA
CGCTTGGGGAAGTAAGACTCCTTCTTCTGCTGCTTGAGGGTCTTGAGCGACTTCTCGTGCGTGGAGAGCTGACGACGGATGGCGCGCGTCTGCTTGCGGC
GCAGGTCCAGGGGCACGTGCTTCTTGCTGCCCAGGGCGGCGCGGAGCTTGGCCTTCTGGTTCTGGTTGTACACCGTCAGCACGCGGGCGATCGACTTGCG
CACCACGCGGATCTTGCTCAGCTTGGAGGCGGCGCCGCCGATGACCTTGGCCACGCGGAGCTGGGCCAGCTCCTGCTGGTAGTCGTCCAGCTGACGGAGC
AGCTCAGTCTTGCTCTTGGTGCGGAGCTCGTGCGCCTTGATCT