Description :
From Genome Similarity Track
Location :
contig_2:76758- 77937
Transcript NameFunction/comments
g448.t1hypothetical protein

Sequence
1179 bases(100 bases per row)
CATATCACACTCACTGCAGAACACACTCTGGCAGGTGGCGCACTCGTACGCGGCGCCTTCGCCGTCCAGTCCCAGAGACAGCAGGCAGCCAAAACACTTC
TTCTGGACCAGTTCTGGCGTTACCTTGGCTCCTTTCTCGCCGCTCACTCCAGACCGCAGCAAATGCTGCGTAAACTTGGCCACTGGGAACAAGTGGTGAT
AGGACCGGGAGATGCGGCGACGAGACCAGTGGCAAGTTGCACACTTGGCAGGTCGTCGGTAGGTCGCAGCTCTTGGACTTGCAGCGAGGACAGACGTACC
CCACTGTTGTGAACGCTTGGTGGCAGGTGCAGAGCGACAGCGCTCCGCTGCGCCGCTGCGGGAACCCCATCTCTACGAGCGTCGCAAAGCGCGAAGCCGC
CGTCGCTACGGTGGGCGACGGGAAGGTGAAGGCCGTCATGAGCCTCTTCATGTGGTCGGCGTCCACCGCGACGTGGTAGGTTCCGTCCGTGCCGTCCGCA
ATGCGGCGCAGCAAATGCATCTCGGCTCCGATGCCAATGAAAGACACGCGGACGTTCTCGCGCTTGAGCGAGGCCAGCGTCTGGAAGATGTCGCCCGGGT
CTGCTGTCACGAGGTTGCCATAGACTACGACGACCTCTCGACTGCCATAGGCGGGCACTGTCTTCAACGAGCTCTTGGCGATCTCCAGCGCGTTCTGCAG
CGACGGCTCCTTGTCCACCGCTAGCGCCCCGGCGATGCGTTCCATGTGCGTCTTGGGGTTGCCCGACAGTTCGCTGAGCTTCTCGGCCGTCATGCCCTTG
ATGCCGATCACGCCCAACTGGGAGATGGGGTTCTGGTCAAAATAGTCCTTGACAAACTGCTGCAGCACCTCGGAGACACAGCCCAGGCGGTGCGGCTTCC
AGTCCTTGATGGCCATGCCGCGGGACAGGTCCATCACCACGTACGTGTAGCGGATCAGGCCCTTGCGAACATTACGCGCGATCTCTAGTCGTCTACAGTG
GTCAGATATAACGTCAAATACCGGGTTAGTACATTACGCTAACGGAATCCGCACGAGACCAGTTTAGTGCGCACCGCTGCCGCTGCTTCTTCGTGACCGC
GTGGTCGATCTTGAGGTTGCCAGAGTCGTCCTCCTGGATCACGTCCCAGCTGCGCTCCAGTGCGCCCTCCCACGCATAT