Description :
From Genome Similarity Track
Location :
contig_25:767317- 768919
Transcript NameFunction/comments
g5957.t1XP_009526615.1 hypothetical protein PHYSODRAFT_498401 [Phytophthora sojae

Sequence
1602 bases(100 bases per row)
TTCTCTGACTACACACACCATTTTCACGCGCACGTCGCCAAGCACCGGATTTTGCGTAGTCTGCAGGAGCAACCAGCGCTTCGACTTACCTTTGAGCTCA
AGCGCAAGGCCATGAACATCCACGGCGCGACCACCTTCGACGTGGTGGCGACTCCGGCCCCGAAGGCAACCACTGGCGGAAAAAGTATGGTCTACAACGG
AATGGCGTCGTTCGAGAAGGACGGACACGCCCACGAGTATTCGCTTGTGGATGGAACGGCCTACTACACGCGACGCCCGAAAGACAACTCGGCGGCGGAG
AACGAGTCAGGATGCCTTCCGTCGTACTCGGTTCCGCCTATCGAGAGCGTGTTGAGCGCCATTCACGGTGCCTCCACGGCCACCAACCTGATCAAGCCTG
GTGATCTACAGCAGAAATGTCCTGGTGGATCCGTGATGGTGTTCCCATTCGCAGGTGAAGACTTCGTGTTATGCTCGCACTCGTCGTGGTTCAAGGACGA
CGGGTTTAAAATCCTAGGCTCCGACCTGAACATCGACGTGAAGTATGACCAGACCACGCCTACGATTGTGGCTCCGCACGTGTCGACAGAGGCATTGGCT
ACGTGCGGAAAGGTTCCGTTTGGCGAGCAGATCACTCCGTCGCTGCCATCGCTCATGGCTCGGTCGTTTTCGGAGTGGGGACACCGTGCCCTGCGCGCGG
AGGAAGCTGAATTCAGTCTGTGGAATCTCATCACGGATGATGTTTGCGGCTGCAAGGGCGCTGAGCGATCGTGTGTGTTTATTGCTGGCCTTAGCTCGTA
CGAAGACCACGGTTTGACCGATGATGACCCCGAAGGCTACTTTGGCGATGAACTCAGCGACCACACACCGTGTTGTTCAAGCAGGAAGTTCATCACGCTA
GCCACGAAGGATAATTCCTGGTACGATCTTGTGTTCCAGCAACGCCTCGTTGATCTCCTTATTCAAGCGAGCGGTACAAGTGATCCCGCTACAGGAACGA
TCAAGGACACGATCATTTTCGGCCACTCCATGGGAAGCCTCACCTTGGCTGGTGCAATTGCAAACGGCAAGGCCATTCTTGACCCGTCGACGTCTTGGGT
GGCTGCTAGCACTCCAATGGAAGGCAGCATGGGCTCGAACTACATTCAACAATCGTGCAGTGGGTCACAAGATGGCTTCCTGGCCAGCCTCATCGACTTG
TTGGGCAACTGCCCTGCAAACACTGGAGAGTCGTCACTTGTCTACCAGGGCTCGGACCTATCTTCGCAGACGTTGAATGACGCGTATGTTGCTGCGCAAG
CCGCGTACACTGCGAACGTGGATGCCGTAATGTGCAGCAAAAGTTTCACTGGCTTGGTGACGCTGAAAGCTGCTATTTACGCGCTTGCGGGTGAAATGCT
GCCGCACCATTCTTCGGAGAACGATGGTATCGTGGAGTACGCAAGCTGCGCCATGGGTCTTCCCCTTGACAGCTTCGACACCTCGTATAAAAGTGTGCGC
TACGTGACTGAGCTGAACCACGTGGATACGTCGTTCCGGAACGGCGATGGCGTCTTCAGTGACGCGAAGAAACCTTTGAAGTGGTTTGAGTGCCTCCTGT
AA