Description :
From Genome Similarity Track
Location :
contig_25:767306- 768908
Transcript NameFunction/comments
g6236.t1RAW31609.1 hypothetical protein PC110_g12049 [Phytophthora cactorum

Sequence
1602 bases(100 bases per row)
TTCTCTGACTACACACACCATTTTCACGCGCACGTCGCCAAGCACCGGATTTTGCGTAGTCTGCAGGAGCAACCAGCGCTTCGACTTACCTTTGAGCTCA
AGCGCAAGGCCATGAACATCCACGGCGCGACCACCTTCGACGTGGTGGCGACTCCGGCCCCGAAGGCAACCACTGGCGGAAAAAGTATGGTCTACAACGG
AATGGCGTCGTTCGAGAAGGACGGACACGCCCACGATTATTCGCTTGTGGATGGAACGGCCTACTACACGCGACGCCCGAAAGACAACTCGGCGGCGGAG
AACGAGTCAGGATGCCTTCCGTCGTACTCGGTTCCGCCTATCGAGAGCGTGTTGAGCGCCATTCACGGTGCCTCCACGGCCACCAACCTGATCAAGCCTG
GTGATCTACAGCAGAAATGTCCTGGTGGATCCGTGATGGTGTTCCCATTCGCAGGTGAAGACTTCGTGTTATGCTCGCACTCGTCGTGGTTCAAGGACGA
CGGGTTTAAAATCCTAGGCTCCGACCTGAACATCGACGTGAAGTATGACCAGACCACGCCTACGATTGTGGCTCCGCACGTGTCGACAGAGGCATTGGCT
ACGTGCGGAAAGGTTCCGTTTGGCGAGCAGATCATTCCGTCGTTGCCATCGCTCATGGCTCGGTCGTTTTCGGAGTGGGGACACCGTGCCCTGCGCGCGG
AGAAAGCTGAATTCAGTCTGTGGAATCTCATCACGGATGATGTTTGCGGCTGCAAGGGCGCTGAGCGATCTTGTGTGTTTATTGCTGGCCTTAGCTCGTA
CGAAGACCACGGTTTGACCGATGATGACCCCGAAGGCTACTTTGGCGATGAACTCAGCGACCACACACCGTGTTGTTCAAGCAGGAAGTTCATCACGCTA
GCCACGAAGGATAATTCCTGGTACGATCTTGTGTTCCAGCAACGCCTCGTTGATCTCCTTATTCAAGCGAGCGGTACAAGTGATCCCGCTACAGGAACGA
TCAAGGACACGATCATTTTCGGCCACTCCATGGGAAGCCTCACCTTGGCTGGTGCAATTGCAAACGGCAAGGCCATTCTTGACCCGTCGACGTCTTGGGT
GGCTGCTAGCACTCCAATGGAAGGCAGCATGGGCTCGAACTACATTCAACAATCGTGCAGTGGGTCACAAGATGGCTTCCTGGCCAGCCTCATCGACTTG
TTGGGCAACTGCCCTGCAAACACTGGAGAGTCGTCACTTGTCTACCAGGGCTCGGACCTATCTTCGCAGACGTTGAATGACGCGTATGTTGCTGCGCAAG
CCGCGTACACTGCGAACGTGGATGCCGTAATGTGCAGCAAAAGTTTCACTGGCTTGGTGACGCTGAAAGCTGCTATTTACGCGCTTGCGGGTGAAATGCT
GCCGCACCATTCTTCGGAGAACGATGGTATCGTGGAGTACGCAAGCTGCGCCATGGGTCTTCCCCTTGACAGCTTCGACACCTCGTATAAAAGTGTGCGC
TACGTGACTGAGCTGAACCACGTGGATACGTCGTTCCGGAACGGCGATGGCGTCTTCAGTGACGCGAAGAAACCTTTGAAGTGGTTTGAGTGCCTCCTGT
AA