Description :
From Genome Similarity Track
Location :
Scaffold_60:76728- 84822
Sequence
8094 bases(100 bases per row)
GGGCGTCGGCGGTAGTGGAATCTTAGACGGATCTTCATCTTGAATCATCGGTCGACTCACAGGCTGCTTTCCGGCATTGATGCCAACAGCGCCAAATGCC
TTCCGAAGCTTCTTCTTCCATTTCTGGAGAGCAGCTCCGGCTTCATGTGGACTCCAATCCTGGAGCGACATCGTCGATGGGTACGTCTCGTTCTCGAACA
CCAGCGACAACAGTAGCGAAACTGAATCCTCGGCAACTTGACTAGTCGAAACCGAGTTGACTGGGTATTGAAGTTCCTGCGCAAGCGCAGGCCAGTCGGC
TTTTTTCTTGGGGATGGGCTTGAACAGCCGCATCCACTCATCATTCTGCATCAGCGCTTGTACGCGGTCGAAAACGCGCTTGGCGGCTGGTGTATCACCG
TTGATAGGTGGGCGAGGTGCCTTCAGCAGTGCTGAATGCTTTGCACTCGCCACCGAAGGTTTAGAACCCTCGGTCCCATCGTCATAATCTTCGTAGGCGG
GTTCCGGTCCCGCAACATCATCGAGCTCGTCGGCGAGGTTCCTCGAAAGGGACCTGGTCGCCCCGCTCAGCCCCGATGATAGCGTGGCCGTCTCCGGCGT
CGCTGCGCCTGGCTCTAGAGCCGGCGTCTTATCTTCGTAATCTTCATAATCGTGGGCGTCAGGACCGATGTCCGCTTCGTCGTCGAAGCTCACTGAAAGC
TCGGTGGCGGCTGCAAAGCGCGCAGCCGGGCTTGAACTCTCGTTGCGAGCCCCGCCAGACTTGGCAGGCGTAACTGGTACCGTCGGCTGTCCTTTCGCCA
TGTTTCTCGTCTTTTTCTTGTTAACTTGGGCGGTGTCACGTCTTTGTCGACGGGTGATAATCCGCAACCACGGAGAAATCACTACACCACATCTGCACCA
ACTAACAACACCTACTAAACGACGACGGCACGCTGAAAGTGACGGCTCTGGCGAGGACAGTGTCGCGGAGACTATTGGTTTGGCGTCAGCAGATAATGAA
CAGGGCAAAGACACAACCATAGCCGCCCCAGATCCTAATGTCGACCGGACGCCAAGGGTCAGACGCACCAAGTCGTATCCCGAACGTTTGGCAATGGAAA
CGTCCCGTGTGAGCTTTGTAAACAGAGTTCCGCCGATGCGACAGCTCGAGTTCTCGACATGGACCGAGTTCGGTGATGTTATGGAGAAATATTGCAGCGA
ACACTTCCTACTATTCAGGGCCCGAGACTCACAGACGGTGAAAAAACACAATACGTAAGTAAGATTTATAATATATTTTAATACTTTTAAATTATATCAG
ACTGACTAACAATAATGCTTGTTTTTATGTTGTACATTATAGATTGGTCAAGCGGCAGATACCAAACAAGATGCAGCACAGCTACAAGGTGTTTCGTTGT
ACCCATGGTTGTCCTCAGAAGTCTCGAGGTAAAGGCTTGAGAAGTACGCCAACTAGATACACTGGGTGTAGAGCTAGAGTCACGGCCACTGTGATGAATA
CTGCAGACGAAGACCATGATCCAAAGTGGTGAATCGTCCTGCAGAACTGGGTAAGTAATTATTTGACAATGTCGCTGAGAGTACGAAATACTAACAGTAT
TATAATTAGACCTGGACACACAATCATCGAACAAATGCATCAATTTACTCCAGCTATTTTGGAGCAGGGTCTGTAGCTGAAAATAGCATGGTAGCGGATC
AAGTTGGCGTTCTTGCGGATGCCAACACGGGGTCACATCACATTCAAGAGTTTCTTTCCGGTGCTTTGGAACGCCACGTGACATCCCAGCAAGCACGCAA
CATTGTCAGAAAGGTGTTGCAAAGTACATCTGCTGACAAAAAACTTTCGGATATGCTGGATACCTTGGCATGTTCTGATGACAACGAGGTTCTCGTTCTT
CAAGATCAGAACGACGTGACGATTGGCGTTGTGATACAAACTGCCGTACAGAAGTTAGCGTTTGAACAGTGGGGATAGACTCTTTGTATGGATTGGACTT
ATGGTACAAACAACTTGGGATTTCATCTTGGTAAGTTTTTTTTTCATTTATTTTTGGGGCGCCCTTATCTCTATAGCTGAGCGCCTTTATCTCTGGTGCA
GCACCTTTAATTATTTTTGTGTTTAATTTCACACAGGGAGTCTTCTTGTTACCAGTGCAACGGGGCGGGGTGTGCCGGTTTTGGACTTTATTGCGCTTGA
TGAAAAAGAATCTACTATGGAGGCGATTCTTCAGTTTTTCAAGAGGAAGAACGAAGGTTAGGCACAAATAGAGACTTTAGTCATTGACAAGGACTTCAAG
GAGTGGAGAGTGTTGGAGAGGTGCTTTCCCGATGCAACCGTACTCTTGTGTCAATTTCACACTATGGCGAACTGGAAGAAGGTCGTCAAGCGGGCAAAGT
ATGATCTTACGGGCATTCAGCAAGATGAAGTCGAGTTTTCTATTAAGCAGATGATGTACAGCACTACAACAGCGGCTTACAATAGATCACGAGATGGATT
CGAAAAGTTTTGCAAGGGCGAGTGTCCGGATATTTGCAGCAAGCCCTGTCCAGAGATTTTCCAGTACTTCCAGGAAAATTGGGAGTGGTGTAGTGATATG
TGGGCCAACCATGCGCGCGGAAAATACTTCACGGCTGGGAACACTACAACTAACAGGATCGAGAGCAACTGGAATCAGTTAAAACGTCTTCTTGGTCGTA
AAACGAGAATCGACCGAACAATCGCTGGCTTGCTTCAGAACCAAGTGAACATTGTGAATCACTTGTTGTCGTCTATCCGAAGAACTTCCACACAGTCCCG
TCCTGTTCAAACCATTCCTCCTTTTTTGCAGCGCGTTGCGGTCCATCTTTCGAACGATACGCTGGCGAAAGTTTCGACTCAATGGGACCTGTTCATGGTG
AACAAATCTGAGGCCACCTGTACGCAAATAGGACCTACTCAAGCGGAATGGAAAGTGTATTTAGCTGGACAAGAAACCATAGTAGACGATACTTTATGGT
CGTGCAGTTGCCTTTTTTACAAGAGTCGGCGACTGCCTTGCCAGCATATCATGACGGTTGCCAGCAAAGGACATGGATTCATCTCGCTACCTGCGCTAGC
AGTGCCCGCACGATGGAGTATGAAAACAACTGAAGAACTTTACGACACACTGGAAAAGGGTTTGAAGTCTGTTCGCCAAGTGATTAATATGGTGAAGGCT
CGACCGATGAACTTAAGGGCGCCCAAAGCCCATCCTGCACCCTTAAAAAGCAGCTTCACCTCCAAAGCGCGAGTCGGAAAGCGTTGTGTGGAGTATGTTC
GTCTTCGACGCCAAGAGGAAGGTAATATGGTAGTGCTTTCAGGTGCTGAGAAGTATGCAAGGGCCCAAGCTCTATTCGGACCAGTAATTGAGAAGCTGAG
TGGGTTATCTACCTTTGAATTCTACGAGCAGATGAACAATTGGAAGTCTTTCACCGAAAAACAACTTGGTGATTGTGCTGAGAACACATCCTCAACTGGT
GCAGATTCTCCTTTTACTGGAGCTGGCAGCGATTCTGACAGTATATTTGATCCGCTTGACATCGCAGATGTGATGGCCGAAATGCAGGCCGATCAGGAAT
TGGGAATGTAGGGTGAGTCATTGGCGGTGTTGGCACGAGAACGAAAATTTGCGAATGGCGAGCCTTCCCATCCTCCGTCGGAAGAGTCCGAACTTGAAGC
CACCCAATTATCCGAAACACCAAAAGAAGACAAAAAAAATGTATGGCGAGATACATACGAAAAGTCTATTTCGAACAGCAATGCTTTGGAATGTAGCAAA
GGCCGCCGCTGTGAGGACCAGTTAAACGAAACCCAAAGTGATACGACCCAACCACTGAATTCCCGCCGTGTTGAAGTGATGAAACTTCCAGATCCGAAGC
CTCGTACTCGAAAGAAGACACGACAGGGGTGGATTGCCAAGCAACCCAAGTTGGCTGTTGTTCTGCTTTCATCGAAGGTTACTGTATCGCTGACCCAGAT
CATCCAGTGGGCTAAATATTACCCGAATGTGGAGAAGGTGTCAAACGTGCTCGACCAGTATCCTGTTCGCATGGATGACAAGTTTCTACAAGCCCGTCCT
GTTACGTGCAAAGTTGCTGATGAAACCAGTGGTGACATCACAAATGACCATGCATTTGTCATACCTGCCTCTCTCTTGAAGAAAGCGTCTGCTGCAATAA
TCTTAAAACGCGAGGAGCTGCAAGCGGCAAATCAGGAAGCTCCGTGGGGTATGCTGGTCTCATTTGGCTCAGAAAATCTCGCTCTACACAGGTGAGTATT
TTTTAATATTGATGGGTTAAGGGCGCCCTTCATGTGTTAAAGGCGCCCTACATGTGTTAAGGGTACTTTTAGAGAAATAAGGTTGCACCAATTTACACAA
ACACTACTAACCCCTGTTCGTATGGAACTTACAGCACTTTCTTAAACAGAATTGAGAATTTTTACGTACTCAAGGCAAAGGCCAGGGGATTTATCGAGGA
TGTCAAGTGGCTGAACCAAGATTGGCGCCTTGTCTAAGCCCATCCAGTCGAACCTTTTTCCTTGGAGGTTAAAACAAGTGGACTACTACATTCAGAATCT
GCAAAGGTTCACCAAGCTTTGGCTGAAGACGTACTTCAGAGATATTCAAACTGTTCGCTGATGACGATTTTGAAGAGCAAGTCGGGGTCCGCTTTCGTTA
ATTTTATGGATGTAGCTGCCATAATTCCTCGCAACGCAATGCTGAACGACGCAGTAATCGGGACGGGGATACAGATGATCACTGACACGGTTAAAGGAGC
TGTTGGTTTGACTTCGTTGCTTATATGGCCAAACCAGCCAAAACAGTGGCTATCGGAGACACCATTCGTGATTTTGCCATTGAATCTGGATAGTATTCAC
TGGGGTGTTATCATCGTGGAGGTGGCGTTTCCAACAACATTACGCGTACATTTTTACGAGCCTTTGCACCAACGATGTTATCAAAGAGAGATGAAAAATG
CCTGGAAAAAACACATTGATGCCATATTTGGAAAAATGGCACACAGGAAGTGGGGCCAAGGAGCAATTTCCCAAAGAAATTTTAAAAAAGTGGATTGACG
AGCCTACTCAACCCGATGGCACAAGCTGTGGACTTCTGATGTTGGGAATGGTTTACGCTTTCTTGCGCAACGCCCATAGGTTTGAGCGTCATCGTATCAC
GGAGGCCTACGTAAGAGTGATGCGGTTGAGATTGACGTGGCTGCTGCTGTGTACAACAAATCCTGCCCTACGGAATGAAGAGGAGTTTAAAAAAATGCAG
AAGACGGATGAAGAAGTTACTAAGCTCACACGACAATGATCAGGCGTTTCAATGCTCGAGGTACTGCTTCACGCGAAGAGATTGCTCATTACTATAAGAA
TAAGAAAGAATAAAAAGCTAAACGTTTTGGTTGAGAAGAGTTTACCAGCATAGAATTCAGCATCCACTTCACTGAGCAGGAGGGTAATTCATAAGAACTC
TAATAACACGCCCCAGCACCATCCCATTCGACGACGGAAAACCTCTCGGAGTTGGAACCTCTCCGATGCTTGCATACAGCTCATTGATGATCTCTTCCTC
GCGAAGCAACATTGCTTCGAGCTCCTCGCGAGCGTACAGCACGTCATTGAGCGCCTCCATCATCTTCTCCATCTTGTCGTGTATCTCTTGCAGAGCCTGT
GGTCTTGAACGCAGCAATTCACGCGCCAGAACTTATTGATCCATAGCAATTACCTTTTTCTTTGTTTGCTGTTTTGGAAAAGAGATCAGACGATGTTACT
GTAAATTTTGTAGCATCATTTTAGTTTCGTAAAATTTCGCCTCTTTCGGCAGATTTTATGGTATTTTATTATCATTAATAAGGGCGCACTTCAGTGTTAA
TGGTGCTTCACTGCAATAGAGGTGCTTCAAGGCTGTCGTATTGTCGTAACGTTAGGGTGCTCTAACGCCATTCCTATTATTGGCTAATCCGGATTTGTTG
CTTAGATATTCCTTACTCCAACTCCAGAAACTACAGTTCTCTATTGACCGTGGGAGCCACTCTACCGGTAAAGAATACCTAGACTGTATTGATACTTCTA
TTGTATGCTCGGTTTATATTATAGGGGGAACCGGGTCGCAAAGGGTCATTACTAACTGCTCGGTATTACGTAACTGTCATTAAAAAATCTACTTTTACTA
TGGGCTATCGTGCCTCCATTTTAGTAGATTGGCCGCATCGCATTTCGTGTCTGGCCTATAGAAACGTCTAATTGGTTAATATCAGCTTCGGCCAGTAGTA
CTTCTGTACGATAATCGCACTATTATCGGTAAGTGTATGCATCAGACAGATGGTACAAATTGCACCACATTGTACCGGAATGTTGCATACAGTACTACTA
CTGTAGTATCCGAACGGAGGTAGTATATACTACCTCCGTTCGGAAATAGATAACCATTTGTTTTTTTTTGCGCAGCGCTCCGCTTCGTTCATTTGGGCGT
TTATTAATTTGTGAGAGGCTGGCTAGCTAGCTTTATGGCGAGAGCTGACAGTGAGAAACTAAGCAAGGCACAGGCGTTCATGCTCCGCCTTGTAACTACA
GATACAAAAACGGATTTAAGACGCGGGAGGCGGTGGGGGGCTGCTCGCTGCAAGAAGCAGCATGTACGCGTTAGCATTGGCGAGTGAGGTATCGTCACAA
GACAGTGACGTAGGGAGAGTGCCAGCTCGTACTTGCTTGTCCTTGTGCCGGAGGCGCGCCAACTTGTGGGTGGGTGTAAGTAGTGGACGGGTCTGTCTGA
GCGCACGCCGTATGTAGCCTTCCTTGATCATGTGAAGTATTGAGCAACGACAGTTGAGGTGTGTCGTGTTCCTGGCTCTACTTGTCCCTGATTGAACAAG
TCGGTGGCTGCTAGCTAGTTACTTCTTGTTTGTATTGCATAGTTTATTCTACTGATAACTGGAGTCTGTTCTCCTGGATAGAGCTCCCACAATCCCAAAT
TATCGCTGTGGGCGAATCGTGTCTTCTCGTCACGTCCTCTACTAATCGCAATAGGTACTGAGCCCAACTTCGCGTGAAGCTTTGAGAGTTAGCACTCTAG
AGCTTCCTGGCATCACTCCTGATGGCTGCGTCAAGTATATCGGCAGCATTGTCGACCTCCACGGCGATTGCCAGTGTTGCACCACCTACAACTGCGAGTA
GCAGTACCAGTACTACTAGTACTTCTGGATTAACGACTGGTGCTACTTCTGGGTCGTCTATTGTGTTTACTAGTGGTGTGAATACGACTGCAGTTGCTCC
GCTTCAAGGTGGTTTTACTTTCGGTGGAGTGATGACTAGTGGAATATCTGCTACGCTGCCAGTGTCAGGCTTAACCGCCTGTATGCCGATGGGTCTTGGA
TCGACAGGTATGTCGTATGGACCGGGGTTGGCTGGATGTAATTCCGCTGGAGGTGTTACGATGGTTCCTAGTTATCGTGGTGCTGGAGCTGGGGCACTTG
GCATTAAAGACATCTCAAATAAGCCTCCTGTAATGAAGGGAAGTTTTGACCTTTATGCAGTGCAACTTAAGACCTTTTTGACTCGCTTGGGTTTGTGGAG
CGTTATAGACGGTAGTGATATGCGTCCGCTTATGACTGCAAGCTGAGTTTGATGCAAGAGATAACGCCGCGCGAGATGCTATTTTGCGTGGAGTGCCGGA
GGCAGATGCAGAATTAATTTGTCATCAAATGTCGGCGAGAGAGAGGTGGATTCAAATTGAAAATAAACAAACCAAACGTGAATATGCGAATTACATCTTT
GCCCGGCAACAACTTTACGCTAACATGTATACTCGAGAAGTCAAGTTGACTGATTGGTTGCGTGAGATGCAAATGCAGAAGCGTGAGCTTCAGCATTACG
GCAAGCTCATAAGTGATGAGGAGTTTGCAGAAATATTGCTTGGCAATGTTTCACAAACGCATCGTGAAGTTGTTCGGCAGTTCTCTCGTCATTATGCTGT
TCTGGCGCTGCCTGGTGTGCAATATGCCGCCCCCACGTCTGCTCAAGTGATGAATGCCCTGCTGGCTGAAGATGATCTGGATGAGAAAGTGAAG