Description :
From Genome Similarity Track
Location :
Scaffold_200:7671- 15497
Sequence
7826 bases(100 bases per row)
CCCGTCACACTTCGTAGCACTAGTAGTCAATCCACGCCACCGCGGGTAGACTACCTGAAGTTCGTTGCAATGAATAGGAACGACTTCTCCCATCTGAACG
ACTCACAGTTCGAGTCGGTTCGGAAGATGGCAGGCATTTTCGGAATGGAGGCCCTGCAGAGCCTGGTGGTGTCAACACCGGTCGAGCAGTTTGGGCGCGT
CAATGCGTTTGACGCTTACGAGCAGGGGCTCATCGCGCATGTGCGGGAGAACCTGCAGGCTCAGGCGGCGGAAGCAAATCCGCCTCACCCGAAGCCAATA
CGGCTGAAGGTTAAGCCGTATGAAGGGAAGGAAGGCGAGAACCTTCACTTCTGGGTCCGAGAAGTTGAGCTCACGATGGGCGCGGCTCTGATCTCGACCG
AGCAACTTCGTGTTGCTTTTGCACTCTCCAACCTTAGCGGTCATGCTAAGAGTTGGGTCTACACACGGGAAGCAACATCCCCTGGATATTTCACATCCTG
GGCGCAGCTGTGTGAACAGCTCCGAGCCGCGTTCCTCCCGGCGAACTACGAGTACCGCCAGCGTTCGCGCTTCCTCTCGTGTAAACAAGGGAGGCGCGAA
CTGCACGAGTACGTGCAAGAGATACGAGAGCTCACGGCGTCCCTAGTGGGAAACCCACTCAACCAACACATCAAGATGACTGTGTTCATGGACGGCTTTT
CGAGTGGGCCCCGCACGCCCTCAGCTGTTCCGGGCGCAGTCAAACACCCTTGAAGAGGCGATTCAAGTGGCTCTTTAAGAAGAGTACAGCCATCGCCAGG
CGCGTACGCCGGCCTCAGCGTGGCCTGGGAGTTCCTCGTCGGCTCCCGGTCGAACAAGCCCCAACGGACCAGCTCCCCTGGAACTCGGGTCCGCCAAACA
GCGTGACATCCGCTGCTTTGGCTGCGGGAAGATGGACCACTTCAAGCGCGACTGTCCAGCGGAAAGACTCCGCAGACGGTCTTTTCCCAAGCCCGTCCTC
AAGGGTCGCTGGCAGAAGCCAGGATCCCGGGGACAGGGGAACGCCGGGAACCAGTAGGGGCGGGGCGCCCTACTGGGGAAGAACTAAGTCTTCGTGATGG
GTGCGAAGGTGGCGCGTACCACGGGGACTTAGCCCCTGAGAGTCTTCGCACTCTCGAATCGGCGAAGAGCAGCGGCGTGTTGCTCGTAGTACACGGATGT
GTACGGGGATACGATCACCCCTTTAGAATCTTGATCGATTCTGGGGCGTCGAAGATTTTCGCACGCCGCCAGACGGCTGCTCGTAATAGCAACAAGCTGT
CCGATGCTTTGAGAGAAAGCTAGGGCAACGGGACGGTGTCAGTGCGACTGGCCGACGGGAAGGTCGTCACTGTCCATAATGTCCAAGTGGATTTGGCCGT
CAAGTTTGAAGACTTTGACAGCCTCGAACAGCTCACTGTTCTTGATATGAATCCGTACGATATCATCCTGGGCATGCTCTGGCTTGAGAAGCACGAGCCC
TGGATCGACTGGCGAGGCAAGGCAATCGGTGCCAGCCGCCCTGCGCAGTCCGACAGAGCATTTGTGAGTCATGTTCCCACCTCTGTCAGGACCCGGGGCG
CCCGCAAGGACTGACAGGGTACCAAAGCACCTGGCAGATGCTTGGGAGTCGTCGACGTATATGACGACTCCGAGGATGCTTTGATGGTGACGGCGCCCAG
AGAAGGCGCTGGCCAAGTGGGTAACTTAGGTCCACAAGCGGGTAACAGAGTTCCGCAGACAGCTGCAGCTGTCACGAACGCTGGTAATAACATGTTCAAG
GTGGGTAACAGAGTTCCACACACGGTCGCTCAGACCTTAACTGAAGAGGAAGACGTCGGATACGCTTCCTGGGTGGGTAACATAGTGCCACACGCGGTCG
CCCAGACCTTAACGGAAGAGGAAGACGTCGGATACGCTTCCTGTGTGGGTAACACAGTGCCACATGCGGTCGCCCAGACCTTAACTGAAGAGGAAGGCGT
TGAACACGCTTCCTGTGTGGGTACCATAGTACCACACGAGGCCACGAGTGCCTCGGATGTCGTAGCGACGACATCCCTAAACCTGGGCAGCAAAGCTCCC
CGTCACAGCCGCCGTCGGCAAAGACGCCGCCGCCGCCTCAAGTCGGATACGAACTTCGTTCCGATCGACGTCGCTTCAAGCGACTCGGAGTCCAGGGCCT
GGACTCCTCTGACACGAAGTGTGTTATCACATCTTCGATGGCGAGACCGGATTACCAGTCAAGGCATCTGGTGTCCACGTGGAACCGTTACCAGATGTTG
CAGAGATACGGAACCTCGAAGAAATGAAGGCCCAGTCTTTCCTGGCCAACCTCAAGGCTGGAAAAGTTGCCGAGATGGTGCTCATAAGACCTGAGACCAC
TCGGGAGGAGCTGAACTCCTCCTCTGTCTTGGACGAAGACGTCCTGGAAGACCTAAACAAGCAGCGTCAGACGAGCTTGGGTTCTGAGATCCGTAAGAAC
CCCAAGGATCCGGTGTATCCTTTGGTGATGGAGTATGCAGACGTGGTGAACAAGCACCCACCGACCCAGCTCCCACCAGATCAAGGCGTACGGCATGATA
TCGATCTCGTGCCTGGCACAAAGTACTGCGTCACGAGTCAATGGTCCCTTCCACGCGAACAGTGTCAGGTCATCGATGCCTTCTTCGCTGCGTAAGCGAA
GGCAGGCATGGTGTGGGAGTCAGCGTCACCGCACTCGACGCCAACTTTCTGCGTTCGGAAGCCAAACGGAAAGTGGCGCCTAGTTCATGCTTATAACAAG
CTGAACAACGCGCCGGTGCCGGCCTAAGCACCAATCCCACGGAAGGATGTGTTGTTAAACAACAGAGCCGGAAGCGCACTGTACAGTGCGCTGGATTTGG
TAGACGTATGCTACCTGATCCTGATGCGAGAGAGCGACATCCCGCTCACCGCGGTGAGCACTTCAAGCGGCATGCTTTGAGATTGGCTCGTCATGCCGCA
GGGCTTGTCTAATGCCCCGGCGACATTCAATCGCCTGGTGACGCAGCTGTTCCGGCCACTACGTGCCTTCGTACAGACGTACTCGACGACATCTTCATCC
ATAGCCGTGCCGAGGGAGGCAAGACGGCCATGAAGGTGCATCTGGGGAACCTTCGTCGAGTGTTATACGTGATGCGAGCGAGCAAGCTCTACGCCAACAT
CGACAAGTGCGTCTTCGCGTCACCAGAGATTAAAGTTCTCGGGCTTCGTAAGCAACGTGGGCGTTCGGGCTGACCCAGACAAGGTCCAGGCCGTTGCAGC
ATGGCCGACGCCCCGATCTCAGAAGGATCTTCGAAAGTGGTTGGGCTTGGCCAACTACCTTCCCAAGTACAGCGCAGGGTACGCGGGCCTCCTACGCTGG
GAGCAAGAGCACCTGGATGCCTTTGACAGCATCAAGGCCACCCTCCAAGAGGCCCCTGTCCTTGCCCTGCCAGACGAGACGAGGCCGTTCAGGGCCGTCT
GTGATGCCTCCGACTATGCCATCGGTTGTGCATTGCTGCAGATTGACACGGCTGGACACGAACGAGTCATCTCGTTCCAGTCCAGGCAGCTCAAAGCTGC
CGAACGGAATCACCGTGTCCACGACAAGGAGCTCCTGGCAATGAAGTATGCCCTTGTGAAGTTTCGGGCTCACCTTCTGGGCTCATGGCCCTTCGTGATC
TACACAGACCAAGCATCCTTGAGGACGGCGACAAATTCGCCTCACCGCTCCCAACGGATGGCGAGGTAGCTGGCCTTCTTCGCGGAGTACAGCTTCCGGG
TCGAGTACAAGCCGGGCAAGCTCAACGTGCTTGCGGATGCCCTCGCTCGGCGTCCAGACTACGAGTTGACTCACATCAAACGGGTGACAACGGATCTATA
TGATCGGATACGTATGGTGTATCGGGACGATGAGGCTGTCGCGCCTATCGTCTAATTTCTAGCAGCAGGAATGGACGCAAAGTCCTACTGGCTTTCGTCG
CAACAGCGTTTCCGGCTCCACCGATATGAGTTGAAGGATGGCCTCCTCTATTACCGGGTGGAGCCTAGTGAACCACCACGGGTGGTCGTACCCAACGACA
AGGATCTGAAGTTTAATTTTAAAATAGAAATTCCTAAATTCTGTTTCTCGACATCCTCGCGGAGGCGTACGATGCGCCTCCAGCGGCCACTTGGGCCACG
AGAAGACCTTCCTGTCGGTTTTTTAGGCCTTCTGGTGGACCCACATGTACAAGTGGGTCGCCCGATACGTGAAGACATGTGAAACATGTCAGCGGGTCGA
GCCCGCAGGGCACTCTTCGGCTCCACTACAAAGCCTGCCCGTACAGCCTGACTGTTGGAAGTCGATGAGTCTTGACTTCATCTTTAGACTTCCCGCCGAC
GGACACAGCAACACCGGAATTTTGGTGTTCGTGTGTCGGCTGAGCAAGATAGTACATCTCGCTCCAGTGCCCGTTACCGTCACCGGCGAACAAACCGCGC
GGTTGTTCGTCGATGGCGTGTTCCGCTATCACGGTCTCCCGGAGACGATTGTCTCGGACCGAAACCCGCTGTTCACGGCTGCGTTTTGGAAAACGCTATT
TACTTTACTGAGAACTCGTCTGCAGATGTCCACTGCGGACCATCCACAGCCAGACGGCCAGACCGAGCGCGTCAATCGAGGACCTTCTGCGTAGTGTGTG
CGCGGAAGCACCACGTACGTGGTCGACGCAGCTTCCAGTTGTTGAGTTTGCGCTCAACAACGCGGTGCACGCGTCCACGGGGTTCGGGAACGCCGCTCTA
CTTAAGCGGCTTCCGTCACCCCATAGTGCCTCTCACTCTTCGAGGAGATACTGTTTCCTCTAATCTAAGTGGGGGAGAGGCTTGGAAAGCCCTTTCCTCC
CAGGTCTCGGAAGGGAGGCCAGTTTCACTGCGGAAACAAGTGGAAATCTTTGTGGATATCAAGCTAGCGTTGTCAGCAGGGTCCGCGATCCCATGGCAGC
GGCCCAGGATAGACAAAAGGAGTACTCAGACAAACATGATAAAGGAAAATTAAGTGTATTTAAAGTGGGGGACTTAGTGCTACTAGACACGAGGAACCTA
CCGCTAGACACTGCCAGCTCTGTCGGCAGCAGCAAGCTGAAGCACCGCTTCATTGGACCATTCGCAGTCCTGGCCAGGCATGGTGCGTCGTACACTATTG
ACCTGCCTAAGGCAATGACGACGCACCCGACGTTCTACGTTGGACGTCTTAAGCGGTACTATGATCAGCAGGGGGTTGCTGACTCGCAGACCCACCTTGG
CCCAGCTCCTCGAAGCGAGGGCCGCCCACAGAAGTCGACGAAGGCGTCGGAGCAGGCACCCAAGCCTCGGTCGGGACGGCAAAGCTGCGGTCAAGACCGT
AGGCAGGAGGGGGCTCCGTACGAACGGACCCCGGAGCCATACGCTGAGTACGTTGAGTACGCGATACGTCGGATCATGCGGAAGGCCTCGTCCAGATCGG
ACGAAGAGGCCCGTCAGTCCACCCGCAGATGCAGGCTCGCGACTTCACGCTCCAACAGGCCCAGGCGGCCGCAAGACGGGCGAGCTCGCCCTGATTCCCG
GCCTGGGCGGCAGCATCCCCGCCAGTCCCAAGGCCAAGTGCAATCTCAAGCAGAGGACGCGTTGACGAAGGCGGTCAACCTCAGGGCCCTGTGTCGGACC
CGCAGTCGGAGCACTCGGACGAGAGTGGCGTTCGGGTGGCGCCGAGTACTCGTACTCGTACAAGGGCCCCTCCGCCCCTGCTTGACCGGAATGGAGAAGT
TCACTACCACGTGGAGCGGATCCTCCAGGAGCAACGGCGTCGCGGTAAGCGACAGCTCCTCGTGAAGTGGAGGGGTTATGTTCACTCTAAGAACACGTGG
GAGCCGATTGAGCGGCTCCTGATTGATTGCCCGAAGGCTGTCGCAATCTGGATCCACAAGCGGGGGCAGTTTCGTAAGTATTCCGGGGGCTCTTGCCCGA
ACGGGGTACGGACGTTGCTGACACTCCGTACCCGCGCTCATCGTGAGCGCTAGAAGCCGCGCGCTTCAGAATGTCCCTTGGCAGCATACGCTTGCTGACC
ATGTGGGCAAACCGAACACGAAGATCACGCTGGTCCAGGATGCGAGACAACAGCTGATCTTCATGGAGTTCTCGTAGCTCCGAGGGTGGGTACTTGAGAG
ACTCCACCCAAGCCCAGAACATGTCCTCACAAGAACTCCAGCTGGGACAGTTCTCGGGAAGAACCTAGGGGTAGCCCCAAAGAGGGTAGAGACCACCCCG
GTTCTCGGGCTTCTTGCGACAGGTCGTAAAGTCCTTAAGAGGGATACGGTGTGACGCGAGAAGCACACACCGAGCCGCCTCCAAGTTGTCAACAAACAAC
TGCTCCTTTTGAACAAGGGTACGTTCATAAACGCCCCTAGAGGTGAGGCCGCCAACAAGGCCACGAGGACCGACGAGAATCTCGAGGAAGTGGTCAGCCC
CAGAGCTCTCCTCGGGAGGCCAATACCCTCTTGAGTTGATGGCAGCTCCCTGGCTGACGGGTGCCACCACCGAGCCCCCACGCCCGCTGGGCAGCTTGGA
AATCCTCCTGCTGCTGGTCCCGGTCGTTAGAGATCTCCCGAAGCCCAGGAATAGCACCCTCTTCCTCCTCCTTCTCGTCCTCTTCATCCGAGGAATCGAA
GAGTCCCCGATGGGAGTACACAATCTCCTTCTCCTCGCGGAGTGGAGACTTCGAAGCCGTACGCTTCTTAGAGGGTTTGGCGTCTTCGGCTTTAGCGGCC
TTAGCACGCGCATAACGCTCGGCAAGCGAGGGACGTTTGCGAGGTTTCTCTTCCTCGTCGCCACCAGCTTTGGGAGTGCCCGTAGCCTTGACGGCCGGGC
TCTCAGAGCGCACCGACGTCCTGGGACTGTGATCACCGTGATCACTAGCGAGGGACTGCACGCTGTCGTCTTTGTGCTCGCTGGGCACTGGGCTGTACCA
TCCCGTAGAGCCCACATGAGCATCGTGCGTGCTCCCGGACTCGGCTTCGTCCTCACTACCGGAGTCGAACTCACGTTCAGCGAATCGAGGGTTCGGACGG
TTGTCTGGGGAGCCCGAGGGTGACGGACTGCGGCGCTTGCTCGCTCGCTTGCCCACAGCCGCGTCACCAGTTGAGTTAATCGCCTCGGAGGCCACCTGAG
TAGCCTCCTGGAGTGCCGTGCCTTTGCCGTGAGGCTTTGTTCTCTTGGCTTGCGCCTTTCCGGCAGCAGCCTTGGAGCGTGTCTTCGCTTCGCTCTTCGC
ACCGCCACGGGCCATGGTAACGGTCGATGTGGAGATCAAGAAGAGGAGCGCACAGTCTGCAGCTCGAGGCTCTAACTGTGAAGTGAGCCTCCGCCGCGCT
CGCTGCGGCCAAGTCGATGTTTTTCGACTTTGAGAATGAAAGTTTGTGACGTACACTTCTTCATTCTGATTGGTCGGTAAACCGAACCTAAGTGGGGGAG
GATGTAACGGGGTACGTAGCCCTAAGTGTACCCCTAGTTACATGAAGTGTGATACGTCACACTTCGGGATATTTGGTACAAAGTACCAAGGTCGTTCAAA
GCCAACCATTGGTTAACGACATTGCATTTCTATAGGTGACCTATAGTTTGTATTAAACCCAAGCTTTATCTACCTATAAATATACTCAGTTTACATTCTA
CCTTAATTAGGTCACTTCGCTCTCTTTTGAATAAAGAGGGGACCTGTGAACTGCCGTTCACTGAGAGTTTGTATGCTCTCAGAAGCTAACTTCCTCTAGC
GCAAGGTGCTGTGTGACCCCGTCACA