Description :
From Genome Similarity Track
Location :
Scaffold_171:76707- 78444
Transcript NameFunction/comments
Phyci_97539Major Facilitator Superfamily (MFS) putative

Sequence
1737 bases(100 bases per row)
TGTGGACCGCCTACGTGTTCACGCTCTTCTTCTGGTCCGCCCGAAGGTACTCGACCTCTCCACAAATGTGTCAATGCTCCGTCCACTGCTAGTGCAGCTA
ACTCCCGCCTCCATTGCCGCCAGCATTCTGTTCCAGCAGGTCGTGGCCGGCTACGTGTTCGTGCTCACGGCGTCCAACAAGCCCGTGGGCATCGTCAAGG
GCATTCAGGGCATCTCGCAGCTCGTGTTCTCGCTGCCCGGCGGCTACTTCGCCGACCGCACGCGGCGCGACACGATCCTCAAGCTCTCGGGCGCCATCGG
CATCGTGGGCGCCGTCATCACCTTCTTGTCGGTCGAGATGACGTCCGTCACGGGCCTGTACGTGGCCTTCGGGCTCTGGGGGCTCTTCGCGGCCTTCCAG
AGCCCCGCCATGGAGGCGCTGTTCGCCGACTCCATCCCGCCCGGCAAGCGCAGCTTCCCCTTCATGATCAAGTACAACATCAGCAACCTGGCGCAGATGC
TCGGGCCCGTGCTGAGCATCTTTCTCTTCCTCTTCTACGGAGACGAGTGGCAGCTGCCCGAGCTCAAGCCCGTGCTCGAGTTCGGCTGCGTGCTGGCGGT
CGTGGGCTCGCTCACGCTCTTCCAGTTCGACGACGACCGCGCCAAGGACTACATGCTGGACAAGACGCaggaggagaaggaggaggaggagCTGCTCGAG
AAGATGGTCACGCCGTCCCCGCTGCGGACGCCCAAGCTCGTGGGCAATGGCAGCGAGATCGACATGGTCTACGACTACTCGGACGAGGACGACATCACAG
TGGACGACAAGTCCCCGCCCACGGCCACGGAGAACACGGCGCTGCTGCTGCTCAAGGGCAAGACCGCCAAGGAGATGGATCTCGAGCGCCAACAGCGCCT
GCAGGAGGAGGACGATGAGGAGGAAGGGTACATGGCCCACCTCGACGCCAAGTTCCTGTGCTTCCGCACAAAACACGTGCCGTACGTTCTGTTCGTCTCG
GACTTTGTTATCAGCAACGGCGCCGGCATGACGATCAACTTTTTCCCGTTGTTCTTCAAGGAGGAGTACGGCCTCACGCCGATCCACGTCTGCGCGCTGT
TCATGAGTCAGCCACTCGTCGTCATGATCCTCTCGTTCATCGCGCAGCGGTTGTCCAAGCCATGCGGCCGCATGCCGATTATCGCCTTCACGCGCGCGTT
CTCGGTGGGGTGTCTGTTTTCCATGGCTTACGCCCAGCCGATGACACTGCAAATCGTCTTGTTCTTGATGCGCGGTGGCATGATGCGCTGCTCACAGCCC
CTGCGTCGTTCAATCCTGATGGACTACGTACCCAAGAACATTCGTGCGCGCTGGAATGCGCTGGAAGGCTTGTCCGTGTTCTCCTGGTCGGGAAGTGCTG
TGCTCGGAGGCTTCTTGATCGACGCGTACGGCTACCGCATGTGCTTCATTATTACGTCGCTCGTCTACTGCGTGGGCTTAGGCATGGAGATGGTCCTCTT
GCCCCTGACCAAGCACGCCGTTGAAAGATAGAGATAGTTGCCTTTGCCCCACCTAGTTCACGACAATCCGAGTTTGCTAGCATTGCCAACGTTTCAACGA
CAAGAACCCACAAGTGTATTTGGACGACACAAAACGTCAAATGGATTTTGCCCTACGCTACCGACGTAGTGCACAAAGTCAATTGGAAATTCCACCCTCC
CTAGGAGCTGATGTTTGAGATTTCACTGCCATACTCA