Description :
From Genome Similarity Track
Location :
Scaffold_31:76704- 79039
Sequence
2335 bases(100 bases per row)
TGATCGAACTCAAGGACGTGTTCCCTGAATCCGTACCATGCGAATTGTCTAAGGATAAAGGCACTCGACATGAAATCGATCTCAAAACGGGCTCGCAGTA
CTGTGTCATGAAGCAGTGACCACTGCCTCGTGAACAAGTACTTGCGATCGACAAGTTCTTTGCCGATCGCTTAGCTGCGGGTCATGTGAGAGAGTCAACT
TCCCTCATACCTCTCCGACCTTCTGTGTGCGCAAGGCCACAGGAGGATGGCGGATAGTGCACGTATTCAACAAGTTGAATGCTGCAACGGTACCGTCTCA
GACGCCGATACCGAGGAAGGACGTAATCATTGATGGTATGTCACAGAGTACCATCTTTTCGTCCATGGATCTGATGGATGGCTTCTATCAGATCCTAGTG
CGTGAACGGGACATCCCGTACACGTTAGTAAGCACCCCGAGCGGTATGCTCTGGGAGTGGCTAGTAATGCTACAAGGGCTTAGCAATGCCCCAGCCACAT
TCAACAGATTTGTAACAAATCTTTTGAGACCGGTGCGAGACTTCGCACCGAGTTACTTCGACAATGTATTCGTCCATAGCCGGGCTATGGGCGGAAAGAC
GGATGTAGAGGTTCATAGAACACACGTTCGTCAGGTTCTTACACTTATGCGCAAGCATAAGCTGTATGCCAACCTCAGGAAGTGCATATTTGCTGCTAGC
GAAATACCACTTCTTGGGTGCATCGTGGGTAAACACGGTTTACGCCCTGATCCTGAAAAGATCATGGCGATTACCGACTGGCCTCTGCCAGTCGAGGTTC
AGGGACTAATACAGTTCCTTGGTCTAGCGGCGTACTTACACAAGTACTCGCGCAACTACGCTGAGATGATCGTTCATCTCTCTCGTCTCTTGAAAAAGAA
CGAGAAATGGTTATGGAACGCTGATTGTCAACGTTCCTTTGAAGGTATCAAGCAGAGCTTGATGCAATCGCCAGGATGGGCGATTGCAGACCAATACAGA
CCATTTCATGTGGTCTGTGACGCCAGCGATTTCGCAATCGGCTGCACGTTAATGCAGTACGATGCAGACGGCGCAGAGCGCGTCGTCCGCTATCAATAGC
GTCAGCCGGAAGCAGCTGAGCGTAATTATCCAGTGCATGACAAGGAACTTCTTGCCATGAATTATGCACTGGCGAAGTTCGCGTGTATCTCCTTGGAGAT
AGGTCGTTTGTAGTCTATACGGACCATGCGTCATTACGCACGGCCGTAAACAGTCCACACCTCTCGCAAAGGATGGCGAGGTGACTGTCCTTCTTTGAGG
AGTAAAAATTTTCCGTGGAGTACAAACCCGGACGACTTAATGTCGTCGTGGACGCGTTGACTCGCCGACCCGATTTCGAGTCGGCTGTGCAGTCCAACAG
TGGGGTTGATACCACTGTTGCAACGCTAGTCACCAGTGTTCCGTCGTCAACATTGCTTAACGACATAAAAAGGCCTACGCAAAAGATGAGGCTCTTCTGC
GACTAATTGATCATCTGGTGACTCCATCTCGTAAATATCTCAAAGATTTACCGGCCTTGTATCGATCATCCGCGGATTGATACACAACACGCAGCGGGTT
GCTGTATTATACAGCCGTTGCCGGCGACACACCTCGTGTCGTCGTACCAACTCATAATGATTTGCGCTTGCGCATCTTGTATGAGTGCCATGATGCACCA
CCTAGTAGGCATCGTGGGCGTGAAAAGACTAATCTCACGGCAAGTCGCGACTTTTACTGTCCCCGCCAGTGTCAGTTCGTAAGCAAGTACATTCGTGCTT
GTAAAGTGTGCCAGCGGGTGAAGCCCAGTCCTTCATTTCGTGCGCCACTTCAGCCTCTACCAATCCCAGCAGAGTGCTGGCATTCCGTTTCAATGGACTT
CGTCTTCGGTTTCCCCGAAGACGCTTACAAGAATAATGGTATTCTTGTGTTCGTAGACCTATTCATCAAGATGTTACATCTTGCTGCAATTAATGAGTCA
ATCTCAGCACATGGTTGTGCCCGTGTCTTCATTGACACGGTATTCTGACTCCACGGTTTACCCGTGAACTCGTCTCTGATAGAGATCCTTGGTTCACGGC
GGCGTTTTGGCAATCCGTATTCCAATCCCTCGGAACACGTCTGACTATGTCTACTTCTGACCATCCCGAGACTGATGGTCAGACAGAACGCGTCAACCGC
ATCCTCGAAGAGATACTTCGAGGATACGTCCAATCTTTCACAGATTGAAGCGAATTTTGTCGATGGTGGAGTTTGCAATCAACAACTCCGTGCATGCATC
TACAACGCATACACCATTTTTCGTGAACGGCTTCC