Description :
From Genome Similarity Track
Location :
Scaffold_1107:7670- 10805
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_1107-fgenesh-gene-0.3Polyribonucleotide nucleotidyltransferase
Pytiw_DAOMBR242034maker-piw_contig_1107-fgenesh-gene-0.1Sr protein

Sequence
3135 bases(100 bases per row)
GCCGAGGTTTCCTGCTGCGAGCTGCTGTCGCTGCCGCCTGGCAAAAGCGCCTTGAGCGACATCTTGCCGGAGGGGCCCTCCTGGATGCACTGGAAGTCGA
GTTCCTGGCCGACCGAGACGACGTCGCGGATGTTCTCGACGCGACCGACCGCGAGCTCGGTGATGTGCACGAAGCCGCGGTTCTTGGACGGCGTGGTGGA
CTCGAGGATGGCGCCAAAATCCATTACTTCGGTCACGCGCATCGAGTACGTGGTGCCTCGCTTGAAGAACGAGTCGGTGCCTTCGAGCACGGCCGTCTGG
CTCAGGATGCGTTCCTTGGCGCTCTCCGCGTTCTCTGGCGAGCCGACAACCCGGATAGTGCCCGCGCGGCGATCGATGCTGACCGTGACTTCGAACATGC
GCTCGAGGTCGCGGATGTTGGAGCCGCCCGCGCCGATGACGACGCCGATTGAGCCTGTGGGGATCGTGAACTCGACGCCAACGTTGATCGCACCCGAGGA
TGAGTTCTTGAGGTCTTGGCGTGGCTCGGAGATCGTGGCGTTCATCTTGCGGAGGATGTTGGTGCGCGCCTTCTTGGCGTAGTGGATGCCCTTGCAAAGG
ATGTCGAGAGGCACGCCTGGCAGCTTGACGTCCAGCTGGATGGCCGTGATCCCCGCGTCCGTGCCGGCGATCTTAAAGTCCATGTCGCCGTAGTGGTCCT
CCGTGCCGAGGATGTCCGTGATGAGGCGGTAGTTCTTGATCTCCTTCTCGCCGTCGAACGGGTCTCCTTCCGTGATGAGGCCGATCGAGATACCAGCGAC
TGGCGCCTTGATGGGCACGCCGGCGTCCATGAGTGCGAGCGAGACGCCACAGACAGTTGCCATCGACGATGAACCGTCCGAGCCCATGGTCTCCGACGTC
ATGCGCACGGTGTATGGGAAATCGTCGATGGACGGGATCACAGGCAGCAGCGCCTTCTCGGCGAGCGCACCGTGGCCGATCATGCGGCGGTTCACGCCGC
CGACGCGGCCGGTCTCGTTGACGCAGTACGGCGGGAACTCGTAGTGGAGCATCGCGTGCTTCACTGGGATGTCCTTGGTCGGGTCCATGAGCGCCGAGCG
GACCTTGAGGCCGCGGTCCAGCGGTCCGAGCGTCACGGAGCAGAGCGCCTGCGTGTCGCCACGCGTAAAGACCGACGAGCCGTGCGCCATGGGAAGCACG
TCCGTCTCGACCTTGAGCGGGCGGATCGTAAATACCGAGCGACCGTCGTAGCGCGAGTTCTTGTCACCGTTGAGGATCTGTTCGCGCAGCGCAAACTGGA
AGACGTCGTGCGCCGCCGCCTGGAAGAGACTGTCGTCCATCTTACGGCCGTGGAAGTGTTCGCGCAGCGTTGAGATGATCTTGCCGTACACGTGCTTCTC
GCCCGCCTGACGCTCCGCCTTGGTGAGCTTGGGGAAGCTCAACACGAGGTTGGCCTCTTCGAGCCCGGCCTCCTTGGCCTTCTCCATCACTTCGGGGTCC
ACGACGAGGCGGGTGTACGAGCGCTTCGGCTTGCCAAACTGCTTAACGAGCTGCTTCTGTGTCTCAATTACGGGGCCGACCGCGTCGTGCGCGAACTGAA
GCGCTTCCGCCATGCGCTCCTCCGTGACCTCGTCGCCCGAGGCCTCGATCATGAGCGTGCGGATCTCGTTCGCAGCGTACAGGATGTCGAGTGTCGCAAT
GTCGCGCTGCTTCTGGGTCGGGTTCACGATCAGCTGGCCATCAATCTCGACCACACGCACGGCGCCTACAGGTCCGTTCCACGGGATGTCGGACACGGCC
AAGGCCGCCGACGTGCTGTTGATCGCCACGAGCAGCGGGTCGTTCTCCGCGTCGAGCGATTGCACCGTCGCGATCACCTGCGTGTCGTCGTAGTAATCGC
GCGGGAAGAGCGGCCGGATCACGCGGTCGACCACGCGCGACTGAAGGATCTCGTCGTCCGTGCCACTGAACTCGGTGCGCTTGGCTGTGTCCGGGATCAG
GCCCGTCGCGTAGTACTTGACGCGGTAGTCGACCATGAGCGGGAGGAAGTCGTGGCCGCGCTTGCCACCGACCGAGCTAACTGCGGTCGTGAGCACCATG
GTCTTGCCGCATGTGGCCATGACGGAGCCGTCGGCGAGGCGTGCATACTTGCCCACGGAGAAGCTCGTCTCGTCAAGCGAGCCGACGAGCTTCTCTGGCT
CTGCTGGCGCTGCAACAGGAGCCGCTGGCGTAGCGACATCTTCGGTGGCCGTGACCGCAGCAGTAGGAGTGCTAGAGCTCTTGCTTGCTTTCTTCTTGTC
CTCCACGACAGCGTCCTCCTTCTTCCCGAAGAGCAAGTCGCGCAGTCCGAAGAACGACCGCGTCTGCTGGTGCACGTGGTACCGGCTCATGCTGTTGCAA
CTGGCGACGCCATTGCCGTTGACGCTCTGCAATAGACGGCTCGTCTGCTGCTTTTGCAGGCGAGCAGGGAAGCGACGACCGGCGCGCAGCATCCTGGTCA
CTCCTCGATCTTCCTGGGAGCTCCTGGTGTGCGATTGATGTGCACACTTTCGCTGGTTGGCGGTTCGTTGACGACTCAAAATAGAGCGACTGTTCATCAC
CCAAATAGAAGCCTCTCTTCCCTGTCAAAAAAAGGTAGAGGTAGAATTACATCTTTGTATAGGGTGTTTCTCTATTTGTTGCTCGCGGGTGTCCCGCTGT
TTGCAGAACGTCCTGAAACCAACCAAAGCTGGAAAGAAGAGACAGCTTTCGCTATTCACCCAGCACGAAGTATAGTTTCCTCAAGTGAAATCAACTCGTA
CTGGTCCCATATCCAACGCTCTCGCCATTCTTCCTTCCCCCCCTCTGTTATTTTAAAGCTCAAGAAGCCACCACCAAGAAGACCAGCAAGCAGCACCATG
GGCACTCGTACGTACGTCGGAGGCCTCCCCCGCGACGCCACCTCGCGCGAGATCCAGGACGGATTCTCCCGCTACGGCCACGTGTCCAACATCTGGGTCG
CGCGCAACCCGCCAGGCTTCGCGTTCGTGGTGAGTGCCTCTTCATCTTCATCTTCTGCTTCTTCTGCTTCTCGTCGGGTCGGCGGCGACGGCTCAAGCGC
ACTGGCGCTGCGTCGTCTCTCCGCGTCGCACCGCT