Description :
From Genome Similarity Track
Location :
Scaffold_1564:767- 2461
Sequence
1694 bases(100 bases per row)
CAAAAGGACTTGCGTAAGTGAATTGGCCTTGCCATTTACTTGCACAAATACAGTGAAAATTACGCTGATATGGCTCGGCCATTAACTAATCTCATTAAAA
AGGACACAGATTGGCACTGGGACAACACCCATGCTGACGCATTTATGGCAATGAAGGAGATTCTCCTCCGTGCTCCCATTTTGGCGTTGCCAAATCCTGA
GTACCCTTTCAGTGTTGTCTGCAATGCATCCAACTTTTCCCATAGGAAGAGCTATGTTACAAACCGATTCTGCAGGCCACGAGCGAGTTATGGCATTGAA
TCTCGTCAGCTGAAAGCTGCTGAAAAGAACTATCCAGTTCATGACAAAGAGATACTTGCTATGAAGTATGCGCTCATCAAATTTGGAGTACATCTGCTTG
GATCCAAGCCATTCGTCGTCGATACGGATCATGCGTCATTACGCACGGCGACACAGTCACCTCACCTCTCTCAGAAATTGGCTCGGTATCTTTCCTTCTT
TGCGGAATATAACTTCGAGGTGAACTATAAGCCACGCAAACAAAATTTGTTGGCAGATGCTCTCTCTCACCAACCTGATTAGGAGCTTGCTCATGTCACG
ACTTTGTCGTCTCCTATTGAGGAGATCATTCGTGTGGACTACTTACGGGATCATTAATGTGTGGCATTGTTTCATGACCTTAGGAGTGAGGAATACAAGG
ACTCGGACAGTCAATTATCGGCACGCTTGCGGGTCGGCCTGCATCGATATTCCATCGATAATGGCCTCTTGTGCTATCGCAAAGATGTAGTGGATACCGC
TCGCATTGTCATACCTCACAATGAGGATTTAAAGTGCCGAATCCTCTTTGAGGCCCACAATACTGTCCTCAGTGGGCATTTGGGCCAGGAAAAGACTTAA
TGCTATGTGAGTCAACACTACTGGTGGCCCAAACTCTACAATGGGTGATCACATACGTGCGTAAATGCGAAACGTGCCAGCGGGTAAAACCCTCAGCACG
TTCGCCTGCGCCACTCGCCAATTTACCTGTGCCCACGGGGTGTTGGGAGTCCATCAGTAAGGATTTTGTGTTTGGTCTTCCCAAAGACAGTGACGGCAAT
ACGGGAATTGTGGTCTTTGTTGACCATTTAAGCAAGATGGCTCACTTGGCGGCGGTGCCGGAATCCATCGATGGCAAAGGTACAGCTATGCTGTTTATCG
ATCGTGTGTTTCGTCAACACGGGTTGCCGCTAGCAATCATCTCTGATCGCGACCCTCGCTTCACAGGCAAGTTTTGGAATTCCATCTTCAAGGTGATTGG
CACGCGATTGGACATGTCCACAGCGGATCATCCGCAGACCGATGGTCAGACTGAGCCAGTTAATCGTGTCATTGTTGACGTTCTTCGCAGTGTTTGTGCT
GATTCGCCTAAGACTTGGAGCTCGATGCTCCCTGTCATTGAGTTTTCGTTGAACAACGCTGTTCATGCCTTGAACGGCTTTACTCCCTTCTATTTGAATA
GCCTCACGCACCCCCGCGTTCCGCTCACGTTACCACTACGTGGTTCTGGGCTGGGTGGGGGAGTCTGCTGACAAGCTTGCTTAAATAAGCCCTACCACGA
TGCAGAAACAAGTGAGCGAGTTTCTCGCTACGCGCTTTAGTGTCTTACGACATGTGCGTGATGCAATGGATGATAGCCAAGACAAACAAAAGAA